Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208521712:

Variant ID: vg1208521712 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8521712
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGTGATTTTAGTCACACTAGCTCTGTTATTATCTTTCATAAACAAGTTAAAGACTCTTCTATGTGTGTTTATATTTTAGTCACGAAATATGAGGCTAAA[T/C]
ATTATTTATATACTTTGGACGCATGTGTATAATTATATAGGGACATATATTAATAAATGGCACTAGCATTTCCTATGCTTTAATTAATTTGAAACAATGC

Reverse complement sequence

GCATTGTTTCAAATTAATTAAAGCATAGGAAATGCTAGTGCCATTTATTAATATATGTCCCTATATAATTATACACATGCGTCCAAAGTATATAAATAAT[A/G]
TTTAGCCTCATATTTCGTGACTAAAATATAAACACACATAGAAGAGTCTTTAACTTGTTTATGAAAGATAATAACAGAGCTAGTGTGACTAAAATCACCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.10%	20.20%	6.12%	50.57%	NA
All Indica	2759	38.00%	8.30%	9.17%	44.51%	NA
All Japonica	1512	0.90%	42.70%	1.06%	55.36%	NA
Aus	269	5.20%	9.30%	4.09%	81.41%	NA
Indica I	595	59.30%	13.30%	5.04%	22.35%	NA
Indica II	465	35.10%	12.30%	8.82%	43.87%	NA
Indica III	913	24.30%	1.50%	12.49%	61.66%	NA
Indica Intermediate	786	39.40%	10.20%	8.65%	41.73%	NA
Temperate Japonica	767	1.20%	66.20%	0.91%	31.68%	NA
Tropical Japonica	504	0.40%	13.90%	1.59%	84.13%	NA
Japonica Intermediate	241	0.80%	28.20%	0.41%	70.54%	NA
VI/Aromatic	96	6.20%	24.00%	4.17%	65.62%	NA
Intermediate	90	14.40%	32.20%	5.56%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208521712	T -> C	LOC_Os12g14890.1	upstream_gene_variant ; 1603.0bp to feature; MODIFIER	silent_mutation	Average:31.969; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg1208521712	T -> C	LOC_Os12g14900.1	downstream_gene_variant ; 2715.0bp to feature; MODIFIER	silent_mutation	Average:31.969; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg1208521712	T -> C	LOC_Os12g14890-LOC_Os12g14900	intergenic_region ; MODIFIER	silent_mutation	Average:31.969; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg1208521712	T -> DEL	N	N	silent_mutation	Average:31.969; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208521712	NA	4.79E-10	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	6.86E-10	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	1.27E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	2.30E-08	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	4.79E-16	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	1.42E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	1.15E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	6.08E-08	mr1034	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	1.35E-16	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	8.08E-08	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	1.81E-10	8.02E-18	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	2.86E-06	1.59E-15	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	6.29E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	2.96E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	1.52E-17	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	1.90E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	4.96E-16	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	1.64E-09	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	7.61E-07	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208521712	NA	3.07E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251