\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208509487:

Variant ID: vg1208509487 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8509487
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTGACCGGGTTTTGCAGGCCACTGTCAAGCTCTTCGGAAGCCTTCTTCGCCATACACCGGCTTCGCCGCCCGCCATCCAGAAAGGGAAGAAGGTGGCC[G/A]
TTGAGGCATCGGCTTCGGATTACTCGCTGGCGGCACCCCGCTTCGCCCCTGGGGATTTCGAGACCTGGGCAGATCTTATCCCCTTCGTCGAGGGGGTAAG

Reverse complement sequence

CTTACCCCCTCGACGAAGGGGATAAGATCTGCCCAGGTCTCGAAATCCCCAGGGGCGAAGCGGGGTGCCGCCAGCGAGTAATCCGAAGCCGATGCCTCAA[C/T]
GGCCACCTTCTTCCCTTTCTGGATGGCGGGCGGCGAAGCCGGTGTATGGCGAAGAAGGCTTCCGAAGAGCTTGACAGTGGCCTGCAAAACCCGGTCAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.20% 28.10% 2.01% 39.63% NA
All Indica  2759 25.80% 13.10% 2.68% 58.35% NA
All Japonica  1512 41.30% 54.60% 0.00% 4.10% NA
Aus  269 11.20% 29.40% 7.06% 52.42% NA
Indica I  595 41.70% 12.30% 2.18% 43.87% NA
Indica II  465 26.90% 8.20% 2.37% 62.58% NA
Indica III  913 11.90% 16.10% 2.41% 69.55% NA
Indica Intermediate  786 29.40% 13.20% 3.56% 53.82% NA
Temperate Japonica  767 65.40% 29.50% 0.00% 5.08% NA
Tropical Japonica  504 11.50% 85.10% 0.00% 3.37% NA
Japonica Intermediate  241 26.60% 71.00% 0.00% 2.49% NA
VI/Aromatic  96 27.10% 35.40% 2.08% 35.42% NA
Intermediate  90 38.90% 32.20% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208509487 G -> DEL LOC_Os12g14860.1 N frameshift_variant Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg1208509487 G -> A LOC_Os12g14860.1 missense_variant ; p.Val321Ile; MODERATE nonsynonymous_codon ; V321I Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 unknown unknown TOLERATED 0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208509487 NA 3.43E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208509487 NA 4.11E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 3.70E-06 1.31E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 4.43E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 4.25E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 6.53E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 8.83E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 4.35E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 5.49E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 3.12E-06 1.80E-06 mr1626 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 1.07E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 8.03E-06 mr1946 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 5.45E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 4.75E-11 5.48E-22 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 5.75E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 9.17E-11 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 1.21E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 4.75E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 9.90E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 2.05E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 8.36E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 2.83E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 3.79E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208509487 NA 6.27E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251