\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208506304:

Variant ID: vg1208506304 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8506304
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGTGCACCGACGATCGGGGGAGCAGGTCTCCGGAACCTCTGCCTTCGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTCG[T/C]
GTGACTACTCCCTGTTCGTCGACGACGGCTCGTCTTCCTCTCCGCTCGCGTGCTGCGCGCCTTCGTCGACGCCCACAACCGCGAGTAGTTCCTGCCGAGC

Reverse complement sequence

GCTCGGCAGGAACTACTCGCGGTTGTGGGCGTCGACGAAGGCGCGCAGCACGCGAGCGGAGAGGAAGACGAGCCGTCGTCGACGAACAGGGAGTAGTCAC[A/G]
CGAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCGGTGCAGGACGTCGAAGGCAGAGGTTCCGGAGACCTGCTCCCCCGATCGTCGGTGCACGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.00% 12.60% 4.10% 53.28% NA
All Indica  2759 13.60% 3.80% 5.73% 76.84% NA
All Japonica  1512 63.80% 30.70% 1.32% 4.23% NA
Aus  269 5.20% 1.90% 3.72% 89.22% NA
Indica I  595 20.50% 5.90% 9.92% 63.70% NA
Indica II  465 8.60% 7.30% 7.53% 76.56% NA
Indica III  913 11.90% 0.40% 0.66% 86.97% NA
Indica Intermediate  786 13.40% 4.10% 7.38% 75.19% NA
Temperate Japonica  767 36.90% 55.50% 2.22% 5.35% NA
Tropical Japonica  504 95.80% 0.40% 0.40% 3.37% NA
Japonica Intermediate  241 82.20% 14.90% 0.41% 2.49% NA
VI/Aromatic  96 30.20% 0.00% 2.08% 67.71% NA
Intermediate  90 41.10% 22.20% 4.44% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208506304 T -> C LOC_Os12g14860.1 upstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:16.839; most accessible tissue: Callus, score: 35.178 N N N N
vg1208506304 T -> C LOC_Os12g14850.1 downstream_gene_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:16.839; most accessible tissue: Callus, score: 35.178 N N N N
vg1208506304 T -> C LOC_Os12g14840-LOC_Os12g14850 intergenic_region ; MODIFIER silent_mutation Average:16.839; most accessible tissue: Callus, score: 35.178 N N N N
vg1208506304 T -> DEL N N silent_mutation Average:16.839; most accessible tissue: Callus, score: 35.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208506304 NA 1.70E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 5.00E-07 3.66E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 5.52E-07 3.87E-16 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 9.78E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 1.67E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 9.94E-08 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 3.00E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 3.24E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 1.42E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 1.44E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 1.72E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 9.56E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 1.22E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208506304 NA 9.75E-10 mr1865_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251