\
| Variant ID: vg1208480617 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8480617 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 76. )
AAACCGGGACTAAAGGGGGGTTACGAACCGGGACTACAAAGGGTTTCTCCACCAGTGCTTCCGCTGGAATGATTTCTCTGTTAAAATTTGTCGGTCCCTA[C/G]
AACATCGTTCAGAAGAAGAATGATGTAGCACATCGAGTTAGGACATCATTTTAATCCATGCGGGTTGGTGGTGAGTGTAACAACCAGCCAGTTCAAAGCC
GGCTTTGAACTGGCTGGTTGTTACACTCACCACCAACCCGCATGGATTAAAATGATGTCCTAACTCGATGTGCTACATCATTCTTCTTCTGAACGATGTT[G/C]
TAGGGACCGACAAATTTTAACAGAGAAATCATTCCAGCGGAAGCACTGGTGGAGAAACCCTTTGTAGTCCCGGTTCGTAACCCCCCTTTAGTCCCGGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.40% | 27.00% | 3.39% | 0.28% | NA |
| All Indica | 2759 | 60.70% | 36.30% | 2.61% | 0.36% | NA |
| All Japonica | 1512 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 15.20% | 62.10% | 21.93% | 0.74% | NA |
| Indica I | 595 | 62.50% | 36.60% | 0.50% | 0.34% | NA |
| Indica II | 465 | 52.50% | 45.20% | 2.37% | 0.00% | NA |
| Indica III | 913 | 65.00% | 29.90% | 4.38% | 0.77% | NA |
| Indica Intermediate | 786 | 59.40% | 38.20% | 2.29% | 0.13% | NA |
| Temperate Japonica | 767 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 44.80% | 21.88% | 1.04% | NA |
| Intermediate | 90 | 78.90% | 14.40% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208480617 | C -> DEL | N | N | silent_mutation | Average:43.1; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
| vg1208480617 | C -> G | LOC_Os12g14820.1 | downstream_gene_variant ; 556.0bp to feature; MODIFIER | silent_mutation | Average:43.1; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
| vg1208480617 | C -> G | LOC_Os12g14820-LOC_Os12g14830 | intergenic_region ; MODIFIER | silent_mutation | Average:43.1; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208480617 | 7.51E-08 | NA | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208480617 | 8.34E-09 | 1.49E-12 | mr1425 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208480617 | NA | 6.10E-06 | mr1558 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208480617 | NA | 3.67E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208480617 | NA | 6.30E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208480617 | NA | 1.64E-08 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |