\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208436651:

Variant ID: vg1208436651 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8436651
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, C: 0.25, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTGGAGTGACTTGGGGGCAGGCAAGCTCTCATGCGCTGCAAATATGTGGCACTTAAAACTCTTCGTCTTAGGAATAGGGAGCATGGATATTTACACGT[A/C]
TTCACGAAAGCATAAGTTCATGATGTGCCAAACATACTAATCGATCCAAATGTGTCCACGCGAGGAAATCAATCCATGCATGCTCAATTTGAATGTTCGC

Reverse complement sequence

GCGAACATTCAAATTGAGCATGCATGGATTGATTTCCTCGCGTGGACACATTTGGATCGATTAGTATGTTTGGCACATCATGAACTTATGCTTTCGTGAA[T/G]
ACGTGTAAATATCCATGCTCCCTATTCCTAAGACGAAGAGTTTTAAGTGCCACATATTTGCAGCGCATGAGAGCTTGCCTGCCCCCAAGTCACTCCAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 47.40% 0.28% 0.19% NA
All Indica  2759 75.90% 23.40% 0.36% 0.29% NA
All Japonica  1512 4.50% 95.40% 0.07% 0.00% NA
Aus  269 77.70% 21.20% 0.74% 0.37% NA
Indica I  595 57.00% 42.20% 0.67% 0.17% NA
Indica II  465 78.90% 20.60% 0.22% 0.22% NA
Indica III  913 87.20% 12.40% 0.22% 0.22% NA
Indica Intermediate  786 75.40% 23.70% 0.38% 0.51% NA
Temperate Japonica  767 6.00% 93.90% 0.13% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208436651 A -> C LOC_Os12g14720.1 downstream_gene_variant ; 3844.0bp to feature; MODIFIER silent_mutation Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg1208436651 A -> C LOC_Os12g14730.1 downstream_gene_variant ; 258.0bp to feature; MODIFIER silent_mutation Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg1208436651 A -> C LOC_Os12g14740.1 downstream_gene_variant ; 1526.0bp to feature; MODIFIER silent_mutation Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg1208436651 A -> C LOC_Os12g14750.1 downstream_gene_variant ; 4322.0bp to feature; MODIFIER silent_mutation Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg1208436651 A -> C LOC_Os12g14730-LOC_Os12g14740 intergenic_region ; MODIFIER silent_mutation Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg1208436651 A -> DEL N N silent_mutation Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208436651 NA 1.31E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208436651 NA 2.34E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208436651 1.43E-06 2.36E-09 mr1910_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208436651 2.56E-06 2.19E-06 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251