\
| Variant ID: vg1208436651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8436651 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, C: 0.25, others allele: 0.00, population size: 84. )
TGCTGGAGTGACTTGGGGGCAGGCAAGCTCTCATGCGCTGCAAATATGTGGCACTTAAAACTCTTCGTCTTAGGAATAGGGAGCATGGATATTTACACGT[A/C]
TTCACGAAAGCATAAGTTCATGATGTGCCAAACATACTAATCGATCCAAATGTGTCCACGCGAGGAAATCAATCCATGCATGCTCAATTTGAATGTTCGC
GCGAACATTCAAATTGAGCATGCATGGATTGATTTCCTCGCGTGGACACATTTGGATCGATTAGTATGTTTGGCACATCATGAACTTATGCTTTCGTGAA[T/G]
ACGTGTAAATATCCATGCTCCCTATTCCTAAGACGAAGAGTTTTAAGTGCCACATATTTGCAGCGCATGAGAGCTTGCCTGCCCCCAAGTCACTCCAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 47.40% | 0.28% | 0.19% | NA |
| All Indica | 2759 | 75.90% | 23.40% | 0.36% | 0.29% | NA |
| All Japonica | 1512 | 4.50% | 95.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 77.70% | 21.20% | 0.74% | 0.37% | NA |
| Indica I | 595 | 57.00% | 42.20% | 0.67% | 0.17% | NA |
| Indica II | 465 | 78.90% | 20.60% | 0.22% | 0.22% | NA |
| Indica III | 913 | 87.20% | 12.40% | 0.22% | 0.22% | NA |
| Indica Intermediate | 786 | 75.40% | 23.70% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 6.00% | 93.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 3.60% | 96.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208436651 | A -> C | LOC_Os12g14720.1 | downstream_gene_variant ; 3844.0bp to feature; MODIFIER | silent_mutation | Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg1208436651 | A -> C | LOC_Os12g14730.1 | downstream_gene_variant ; 258.0bp to feature; MODIFIER | silent_mutation | Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg1208436651 | A -> C | LOC_Os12g14740.1 | downstream_gene_variant ; 1526.0bp to feature; MODIFIER | silent_mutation | Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg1208436651 | A -> C | LOC_Os12g14750.1 | downstream_gene_variant ; 4322.0bp to feature; MODIFIER | silent_mutation | Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg1208436651 | A -> C | LOC_Os12g14730-LOC_Os12g14740 | intergenic_region ; MODIFIER | silent_mutation | Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg1208436651 | A -> DEL | N | N | silent_mutation | Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208436651 | NA | 1.31E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208436651 | NA | 2.34E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208436651 | 1.43E-06 | 2.36E-09 | mr1910_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208436651 | 2.56E-06 | 2.19E-06 | mr1910_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |