Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208436651:

Variant ID: vg1208436651 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8436651
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, C: 0.25, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTGGAGTGACTTGGGGGCAGGCAAGCTCTCATGCGCTGCAAATATGTGGCACTTAAAACTCTTCGTCTTAGGAATAGGGAGCATGGATATTTACACGT[A/C]
TTCACGAAAGCATAAGTTCATGATGTGCCAAACATACTAATCGATCCAAATGTGTCCACGCGAGGAAATCAATCCATGCATGCTCAATTTGAATGTTCGC

Reverse complement sequence

GCGAACATTCAAATTGAGCATGCATGGATTGATTTCCTCGCGTGGACACATTTGGATCGATTAGTATGTTTGGCACATCATGAACTTATGCTTTCGTGAA[T/G]
ACGTGTAAATATCCATGCTCCCTATTCCTAAGACGAAGAGTTTTAAGTGCCACATATTTGCAGCGCATGAGAGCTTGCCTGCCCCCAAGTCACTCCAGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	47.40%	0.28%	0.19%	NA
All Indica	2759	75.90%	23.40%	0.36%	0.29%	NA
All Japonica	1512	4.50%	95.40%	0.07%	0.00%	NA
Aus	269	77.70%	21.20%	0.74%	0.37%	NA
Indica I	595	57.00%	42.20%	0.67%	0.17%	NA
Indica II	465	78.90%	20.60%	0.22%	0.22%	NA
Indica III	913	87.20%	12.40%	0.22%	0.22%	NA
Indica Intermediate	786	75.40%	23.70%	0.38%	0.51%	NA
Temperate Japonica	767	6.00%	93.90%	0.13%	0.00%	NA
Tropical Japonica	504	3.60%	96.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	34.40%	65.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208436651	A -> C	LOC_Os12g14720.1	downstream_gene_variant ; 3844.0bp to feature; MODIFIER	silent_mutation	Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg1208436651	A -> C	LOC_Os12g14730.1	downstream_gene_variant ; 258.0bp to feature; MODIFIER	silent_mutation	Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg1208436651	A -> C	LOC_Os12g14740.1	downstream_gene_variant ; 1526.0bp to feature; MODIFIER	silent_mutation	Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg1208436651	A -> C	LOC_Os12g14750.1	downstream_gene_variant ; 4322.0bp to feature; MODIFIER	silent_mutation	Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg1208436651	A -> C	LOC_Os12g14730-LOC_Os12g14740	intergenic_region ; MODIFIER	silent_mutation	Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg1208436651	A -> DEL	N	N	silent_mutation	Average:44.209; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208436651	NA	1.31E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208436651	NA	2.34E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208436651	1.43E-06	2.36E-09	mr1910_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208436651	2.56E-06	2.19E-06	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251