\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208405606:

Variant ID: vg1208405606 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8405606
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AATTACGGGACCTCCGATCACAATGGACAGGTTTCCACTATTGTGCAACTCTAATTGGGTCTCAAGCCCATCTCCCTCGATGCACAGTCTATCACATTAC[A/G]
TGCTAACCCCTTAGTAAACTGATCTGCCAGATTTTTAGCCGTATGGACATAGTCCAATGCTATCACTCTAGAGTTTTTCTGCTTTCTGACAGACTTCAAT

Reverse complement sequence

ATTGAAGTCTGTCAGAAAGCAGAAAAACTCTAGAGTGATAGCATTGGACTATGTCCATACGGCTAAAAATCTGGCAGATCAGTTTACTAAGGGGTTAGCA[T/C]
GTAATGTGATAGACTGTGCATCGAGGGAGATGGGCTTGAGACCCAATTAGAGTTGCACAATAGTGGAAACCTGTCCATTGTGATCGGAGGTCCCGTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 22.90% 4.30% 20.67% NA
All Indica  2759 56.50% 12.60% 3.12% 27.69% NA
All Japonica  1512 54.50% 42.60% 0.26% 2.65% NA
Aus  269 5.60% 14.10% 29.74% 50.56% NA
Indica I  595 48.60% 25.90% 3.03% 22.52% NA
Indica II  465 48.00% 15.70% 2.37% 33.98% NA
Indica III  913 67.30% 1.50% 2.85% 28.37% NA
Indica Intermediate  786 55.20% 13.70% 3.94% 27.10% NA
Temperate Japonica  767 26.90% 68.40% 0.26% 4.43% NA
Tropical Japonica  504 88.30% 10.90% 0.00% 0.79% NA
Japonica Intermediate  241 71.80% 26.60% 0.83% 0.83% NA
VI/Aromatic  96 13.50% 28.10% 27.08% 31.25% NA
Intermediate  90 56.70% 27.80% 7.78% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208405606 A -> DEL LOC_Os12g14680.1 N frameshift_variant Average:26.614; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1208405606 A -> G LOC_Os12g14680.1 missense_variant ; p.Cys274Arg; MODERATE nonsynonymous_codon ; C274R Average:26.614; most accessible tissue: Minghui63 panicle, score: 56.842 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208405606 NA 1.73E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208405606 9.21E-11 3.41E-14 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 9.27E-07 3.80E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 6.09E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 5.16E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 1.36E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 7.79E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 8.97E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 8.23E-14 3.93E-22 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 1.01E-10 9.41E-22 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 1.39E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 2.21E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 2.86E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 3.46E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 1.82E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 4.47E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 1.44E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 4.91E-06 NA mr1037_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 5.74E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 3.30E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208405606 NA 2.37E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251