Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208375941:

Variant ID: vg1208375941 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8375941
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTGTGGGTACAGAGAACATAGTGAAAATGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTCTGCCAGAAATACATCCT[G/A]
AAGGGGCAGACACTGAACTTCAACACATTACCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGAGATGATGG

Reverse complement sequence

CCATCATCTCTTGCCCTTGTTGCCCTGTCTTGTAAGCAACGAACTCGTCCCAGTGATCCCTTAGCTTCGGTAATGTGTTGAAGTTCAGTGTCTGCCCCTT[C/T]
AGGATGTATTTCTGGCAGAGATCTCCCTTGAAGCTCTGAAACTGTTCTGCCATTTTCTTTAGAGTCCACATTTTCACTATGTTCTCTGTACCCACAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	18.10%	7.13%	13.25%	NA
All Indica	2759	73.40%	0.80%	9.97%	15.80%	NA
All Japonica	1512	44.70%	52.90%	0.20%	2.18%	NA
Aus	269	43.50%	0.70%	18.22%	37.55%	NA
Indica I	595	81.30%	0.80%	9.24%	8.57%	NA
Indica II	465	66.90%	1.10%	12.04%	20.00%	NA
Indica III	913	72.30%	0.50%	8.32%	18.84%	NA
Indica Intermediate	786	72.50%	1.00%	11.20%	15.27%	NA
Temperate Japonica	767	70.00%	26.10%	0.26%	3.65%	NA
Tropical Japonica	504	14.30%	84.90%	0.20%	0.60%	NA
Japonica Intermediate	241	27.80%	71.40%	0.00%	0.83%	NA
VI/Aromatic	96	38.50%	7.30%	7.29%	46.88%	NA
Intermediate	90	60.00%	24.40%	3.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208375941	G -> DEL	LOC_Os12g14650.1	N	frameshift_variant	Average:37.695; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg1208375941	G -> A	LOC_Os12g14650.1	synonymous_variant ; p.Leu196Leu; LOW	synonymous_codon	Average:37.695; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208375941	NA	9.48E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208375941	7.54E-07	5.54E-14	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	2.07E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	3.56E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	3.77E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	1.73E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	4.87E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	6.88E-08	NA	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	6.87E-10	1.51E-20	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	2.70E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	1.14E-09	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	2.55E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	1.83E-10	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	5.38E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	2.06E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	4.41E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	4.60E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	3.44E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	1.86E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	8.01E-09	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	4.52E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	5.56E-07	6.84E-06	mr1655_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	2.37E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	1.27E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	8.89E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	9.88E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	6.34E-20	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	NA	4.94E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208375941	2.29E-06	NA	mr1977_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251