\
| Variant ID: vg1208308635 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8308635 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGTGAAAAATTCTGTGATACAAGTGAATCTGGCAATCGCGGCTGCTTTAAAATCTCATCTCATAATGAAAACTACCATGGTGGTCCGCGCAGATTACGC[G/A]
GCTAGCATCATTATATTTTCTCTCATATAATAGCATATATGTTTTCTCATTATATTATTCAAATATATTGAAATGACAACATAATTTTAAATTTTACAAT
ATTGTAAAATTTAAAATTATGTTGTCATTTCAATATATTTGAATAATATAATGAGAAAACATATATGCTATTATATGAGAGAAAATATAATGATGCTAGC[C/T]
GCGTAATCTGCGCGGACCACCATGGTAGTTTTCATTATGAGATGAGATTTTAAAGCAGCCGCGATTGCCAGATTCACTTGTATCACAGAATTTTTCACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.40% | 0.10% | 7.91% | 69.51% | NA |
| All Indica | 2759 | 12.30% | 0.30% | 7.25% | 80.25% | NA |
| All Japonica | 1512 | 42.90% | 0.00% | 0.07% | 57.01% | NA |
| Aus | 269 | 4.50% | 0.00% | 41.26% | 54.28% | NA |
| Indica I | 595 | 20.50% | 0.50% | 4.71% | 74.29% | NA |
| Indica II | 465 | 16.80% | 0.60% | 12.69% | 69.89% | NA |
| Indica III | 913 | 3.80% | 0.10% | 5.91% | 90.14% | NA |
| Indica Intermediate | 786 | 13.10% | 0.00% | 7.51% | 79.39% | NA |
| Temperate Japonica | 767 | 68.40% | 0.00% | 0.13% | 31.42% | NA |
| Tropical Japonica | 504 | 11.30% | 0.00% | 0.00% | 88.69% | NA |
| Japonica Intermediate | 241 | 27.80% | 0.00% | 0.00% | 72.20% | NA |
| VI/Aromatic | 96 | 29.20% | 0.00% | 55.21% | 15.62% | NA |
| Intermediate | 90 | 36.70% | 0.00% | 10.00% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208308635 | G -> DEL | N | N | silent_mutation | Average:14.695; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1208308635 | G -> A | LOC_Os12g14550.1 | downstream_gene_variant ; 893.0bp to feature; MODIFIER | silent_mutation | Average:14.695; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg1208308635 | G -> A | LOC_Os12g14550-LOC_Os12g14570 | intergenic_region ; MODIFIER | silent_mutation | Average:14.695; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208308635 | NA | 1.72E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208308635 | 7.91E-06 | 1.85E-10 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | 1.52E-07 | 1.07E-14 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 4.00E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | 2.09E-07 | NA | mr1014 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | 8.89E-06 | NA | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 3.58E-16 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 3.95E-09 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 3.13E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 4.89E-16 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 4.47E-08 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 6.54E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 5.13E-06 | mr1578 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | 9.63E-07 | 2.32E-15 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | 1.15E-09 | 1.25E-20 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 1.32E-07 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 1.20E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 4.64E-10 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 2.13E-17 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 2.19E-09 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 9.68E-17 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 3.64E-11 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 5.25E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 1.03E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 2.11E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208308635 | NA | 1.72E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |