\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208308635:

Variant ID: vg1208308635 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8308635
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTGAAAAATTCTGTGATACAAGTGAATCTGGCAATCGCGGCTGCTTTAAAATCTCATCTCATAATGAAAACTACCATGGTGGTCCGCGCAGATTACGC[G/A]
GCTAGCATCATTATATTTTCTCTCATATAATAGCATATATGTTTTCTCATTATATTATTCAAATATATTGAAATGACAACATAATTTTAAATTTTACAAT

Reverse complement sequence

ATTGTAAAATTTAAAATTATGTTGTCATTTCAATATATTTGAATAATATAATGAGAAAACATATATGCTATTATATGAGAGAAAATATAATGATGCTAGC[C/T]
GCGTAATCTGCGCGGACCACCATGGTAGTTTTCATTATGAGATGAGATTTTAAAGCAGCCGCGATTGCCAGATTCACTTGTATCACAGAATTTTTCACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.40% 0.10% 7.91% 69.51% NA
All Indica  2759 12.30% 0.30% 7.25% 80.25% NA
All Japonica  1512 42.90% 0.00% 0.07% 57.01% NA
Aus  269 4.50% 0.00% 41.26% 54.28% NA
Indica I  595 20.50% 0.50% 4.71% 74.29% NA
Indica II  465 16.80% 0.60% 12.69% 69.89% NA
Indica III  913 3.80% 0.10% 5.91% 90.14% NA
Indica Intermediate  786 13.10% 0.00% 7.51% 79.39% NA
Temperate Japonica  767 68.40% 0.00% 0.13% 31.42% NA
Tropical Japonica  504 11.30% 0.00% 0.00% 88.69% NA
Japonica Intermediate  241 27.80% 0.00% 0.00% 72.20% NA
VI/Aromatic  96 29.20% 0.00% 55.21% 15.62% NA
Intermediate  90 36.70% 0.00% 10.00% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208308635 G -> DEL N N silent_mutation Average:14.695; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1208308635 G -> A LOC_Os12g14550.1 downstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:14.695; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg1208308635 G -> A LOC_Os12g14550-LOC_Os12g14570 intergenic_region ; MODIFIER silent_mutation Average:14.695; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208308635 NA 1.72E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208308635 7.91E-06 1.85E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 1.52E-07 1.07E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 4.00E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 2.09E-07 NA mr1014 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 8.89E-06 NA mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 3.58E-16 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 3.95E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 3.13E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 4.89E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 4.47E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 6.54E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 5.13E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 9.63E-07 2.32E-15 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 1.15E-09 1.25E-20 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 1.32E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 1.20E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 4.64E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 2.13E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 2.19E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 9.68E-17 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 3.64E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 5.25E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 1.03E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 2.11E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208308635 NA 1.72E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251