Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208303450:

Variant ID: vg1208303450 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8303450
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTTGAAAAACGTGCACGCGGAAAACGAGAGAGGTGAGTTGGGAAATCTGGGGAATAACACAGCCTAAAAGGAGGCCCATATGTAACTAGATTTAAAAG[C/G]
CACCCAGTATAAACTCGCATACGAAAATCCATTTTCGCAAGCGGATCTTTAAAGAGGCCCGCCTAAAAAAAAATCTATTTTTATAGGCGGATCAATTAAG

Reverse complement sequence

CTTAATTGATCCGCCTATAAAAATAGATTTTTTTTTAGGCGGGCCTCTTTAAAGATCCGCTTGCGAAAATGGATTTTCGTATGCGAGTTTATACTGGGTG[G/C]
CTTTTAAATCTAGTTACATATGGGCCTCCTTTTAGGCTGTGTTATTCCCCAGATTTCCCAACTCACCTCTCTCGTTTTCCGCGTGCACGTTTTTCAAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.90%	26.50%	1.59%	19.97%	NA
All Indica	2759	60.90%	13.00%	0.62%	25.48%	NA
All Japonica	1512	44.30%	50.10%	3.51%	2.12%	NA
Aus	269	7.40%	28.30%	0.37%	63.94%	NA
Indica I	595	56.80%	20.50%	0.84%	21.85%	NA
Indica II	465	59.40%	7.70%	0.22%	32.69%	NA
Indica III	913	62.50%	11.20%	0.44%	25.85%	NA
Indica Intermediate	786	63.00%	12.60%	0.89%	23.54%	NA
Temperate Japonica	767	69.10%	26.50%	1.04%	3.39%	NA
Tropical Japonica	504	14.50%	78.40%	6.55%	0.60%	NA
Japonica Intermediate	241	27.80%	66.00%	4.98%	1.24%	NA
VI/Aromatic	96	33.30%	34.40%	1.04%	31.25%	NA
Intermediate	90	56.70%	32.20%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208303450	C -> DEL	N	N	silent_mutation	Average:42.757; most accessible tissue: Callus, score: 76.182	N	N	N	N
vg1208303450	C -> G	LOC_Os12g14550.1	upstream_gene_variant ; 2945.0bp to feature; MODIFIER	silent_mutation	Average:42.757; most accessible tissue: Callus, score: 76.182	N	N	N	N
vg1208303450	C -> G	LOC_Os12g14530.1	downstream_gene_variant ; 4415.0bp to feature; MODIFIER	silent_mutation	Average:42.757; most accessible tissue: Callus, score: 76.182	N	N	N	N
vg1208303450	C -> G	LOC_Os12g14540.1	downstream_gene_variant ; 1366.0bp to feature; MODIFIER	silent_mutation	Average:42.757; most accessible tissue: Callus, score: 76.182	N	N	N	N
vg1208303450	C -> G	LOC_Os12g14540-LOC_Os12g14550	intergenic_region ; MODIFIER	silent_mutation	Average:42.757; most accessible tissue: Callus, score: 76.182	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208303450	NA	3.10E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208303450	NA	5.86E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	6.64E-07	6.59E-14	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.25E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	3.62E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	5.35E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	4.16E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	2.03E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	5.88E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	8.07E-10	4.80E-20	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	2.65E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.71E-08	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.92E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.20E-10	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	5.31E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.56E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	6.46E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.72E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.93E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	3.45E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	3.34E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	2.17E-06	4.52E-06	mr1707_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.87E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	8.16E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	1.07E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450	NA	2.42E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251