\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208303450:

Variant ID: vg1208303450 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8303450
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTGAAAAACGTGCACGCGGAAAACGAGAGAGGTGAGTTGGGAAATCTGGGGAATAACACAGCCTAAAAGGAGGCCCATATGTAACTAGATTTAAAAG[C/G]
CACCCAGTATAAACTCGCATACGAAAATCCATTTTCGCAAGCGGATCTTTAAAGAGGCCCGCCTAAAAAAAAATCTATTTTTATAGGCGGATCAATTAAG

Reverse complement sequence

CTTAATTGATCCGCCTATAAAAATAGATTTTTTTTTAGGCGGGCCTCTTTAAAGATCCGCTTGCGAAAATGGATTTTCGTATGCGAGTTTATACTGGGTG[G/C]
CTTTTAAATCTAGTTACATATGGGCCTCCTTTTAGGCTGTGTTATTCCCCAGATTTCCCAACTCACCTCTCTCGTTTTCCGCGTGCACGTTTTTCAAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 26.50% 1.59% 19.97% NA
All Indica  2759 60.90% 13.00% 0.62% 25.48% NA
All Japonica  1512 44.30% 50.10% 3.51% 2.12% NA
Aus  269 7.40% 28.30% 0.37% 63.94% NA
Indica I  595 56.80% 20.50% 0.84% 21.85% NA
Indica II  465 59.40% 7.70% 0.22% 32.69% NA
Indica III  913 62.50% 11.20% 0.44% 25.85% NA
Indica Intermediate  786 63.00% 12.60% 0.89% 23.54% NA
Temperate Japonica  767 69.10% 26.50% 1.04% 3.39% NA
Tropical Japonica  504 14.50% 78.40% 6.55% 0.60% NA
Japonica Intermediate  241 27.80% 66.00% 4.98% 1.24% NA
VI/Aromatic  96 33.30% 34.40% 1.04% 31.25% NA
Intermediate  90 56.70% 32.20% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208303450 C -> DEL N N silent_mutation Average:42.757; most accessible tissue: Callus, score: 76.182 N N N N
vg1208303450 C -> G LOC_Os12g14550.1 upstream_gene_variant ; 2945.0bp to feature; MODIFIER silent_mutation Average:42.757; most accessible tissue: Callus, score: 76.182 N N N N
vg1208303450 C -> G LOC_Os12g14530.1 downstream_gene_variant ; 4415.0bp to feature; MODIFIER silent_mutation Average:42.757; most accessible tissue: Callus, score: 76.182 N N N N
vg1208303450 C -> G LOC_Os12g14540.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:42.757; most accessible tissue: Callus, score: 76.182 N N N N
vg1208303450 C -> G LOC_Os12g14540-LOC_Os12g14550 intergenic_region ; MODIFIER silent_mutation Average:42.757; most accessible tissue: Callus, score: 76.182 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208303450 NA 3.10E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208303450 NA 5.86E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 6.64E-07 6.59E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.25E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 3.62E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 5.35E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 4.16E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 2.03E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 5.88E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 8.07E-10 4.80E-20 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 2.65E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.71E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.92E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.20E-10 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 5.31E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.56E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 6.46E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.72E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.93E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 3.45E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 3.34E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 2.17E-06 4.52E-06 mr1707_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.87E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 8.16E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 1.07E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208303450 NA 2.42E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251