Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208277892:

Variant ID: vg1208277892 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8277892
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACGGGTACATTATTGGCCAATTATTTAATTTGTACAAGCTCCTGCATATGTGGTCATAATTTGAATGTGTTGGATGCGATGGTCCACACCTGAACAACT[T/C,A]
GTACATTTACAGAAAATCGACAACATCAGGTGACTACATCACCATTTCAAAAGGGACACACGAAAACTGAGCAAACAAAGGAAAGCATAGGGACAAACCT

Reverse complement sequence

AGGTTTGTCCCTATGCTTTCCTTTGTTTGCTCAGTTTTCGTGTGTCCCTTTTGAAATGGTGATGTAGTCACCTGATGTTGTCGATTTTCTGTAAATGTAC[A/G,T]
AGTTGTTCAGGTGTGGACCATCGCATCCAACACATTCAAATTATGACCACATATGCAGGAGCTTGTACAAATTAAATAATTGGCCAATAATGTACCCGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	21.20%	0.11%	0.32%	NA
All Indica	2759	97.30%	2.10%	0.14%	0.51%	NA
All Japonica	1512	47.00%	53.00%	0.00%	0.00%	NA
Aus	269	69.10%	30.90%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	97.30%	2.10%	0.11%	0.55%	NA
Indica Intermediate	786	95.40%	3.20%	0.25%	1.15%	NA
Temperate Japonica	767	73.30%	26.70%	0.00%	0.00%	NA
Tropical Japonica	504	15.30%	84.70%	0.00%	0.00%	NA
Japonica Intermediate	241	29.90%	70.10%	0.00%	0.00%	NA
VI/Aromatic	96	65.60%	34.40%	0.00%	0.00%	NA
Intermediate	90	64.40%	33.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208277892	T -> C	LOC_Os12g14500.1	upstream_gene_variant ; 381.0bp to feature; MODIFIER	silent_mutation	Average:42.468; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1208277892	T -> C	LOC_Os12g14490.1	downstream_gene_variant ; 3786.0bp to feature; MODIFIER	silent_mutation	Average:42.468; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1208277892	T -> C	LOC_Os12g14490-LOC_Os12g14500	intergenic_region ; MODIFIER	silent_mutation	Average:42.468; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1208277892	T -> DEL	N	N	silent_mutation	Average:42.468; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1208277892	T -> A	LOC_Os12g14500.1	upstream_gene_variant ; 381.0bp to feature; MODIFIER	N	Average:42.468; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1208277892	T -> A	LOC_Os12g14490.1	downstream_gene_variant ; 3786.0bp to feature; MODIFIER	N	Average:42.468; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1208277892	T -> A	LOC_Os12g14490-LOC_Os12g14500	intergenic_region ; MODIFIER	N	Average:42.468; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208277892	NA	3.02E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208277892	NA	4.24E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.82E-11	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	3.41E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	1.44E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	9.75E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	1.51E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	5.11E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	5.82E-08	4.97E-17	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	1.92E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	5.67E-09	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.37E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	6.84E-10	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	6.04E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	4.13E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	6.81E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.79E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	1.93E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	6.28E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	8.06E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	4.69E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	1.59E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	5.99E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	6.57E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	6.09E-10	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.00E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.12E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	1.52E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	5.68E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	8.57E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.32E-14	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.91E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	3.28E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	9.18E-07	3.43E-19	mr1742_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	4.02E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	9.98E-10	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	1.74E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	2.99E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208277892	NA	7.11E-07	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251