\
| Variant ID: vg1208274233 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8274233 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTACGTCTGCTGCCGACTGTGCCCTCGCCTCTACGGTTGGTTTATACTGCTACCTCTATTGATGGACGTCATCGTTTTCATTGCTGGCCGCCTTGTCTGA[T/C,G]
GCCGACTGGCTTGTTCACCTCCACGGCTGCGCGCCTTCGTCATCATTGACTGGCGTCATCGTCATCATCGGTTTGCCTTCGCCGCCGTCCATGGTGTCTT
AAGACACCATGGACGGCGGCGAAGGCAAACCGATGATGACGATGACGCCAGTCAATGATGACGAAGGCGCGCAGCCGTGGAGGTGAACAAGCCAGTCGGC[A/G,C]
TCAGACAAGGCGGCCAGCAATGAAAACGATGACGTCCATCAATAGAGGTAGCAGTATAAACCAACCGTAGAGGCGAGGGCACAGTCGGCAGCAGACGTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 6.70% | 20.52% | 22.41% | G: 0.04% |
| All Indica | 2759 | 50.10% | 10.10% | 18.05% | 21.71% | G: 0.04% |
| All Japonica | 1512 | 55.00% | 1.10% | 21.83% | 21.96% | G: 0.07% |
| Aus | 269 | 28.60% | 1.90% | 30.86% | 38.66% | NA |
| Indica I | 595 | 40.00% | 5.50% | 17.31% | 37.14% | NA |
| Indica II | 465 | 47.10% | 10.50% | 21.72% | 20.65% | NA |
| Indica III | 913 | 58.10% | 12.30% | 16.43% | 13.14% | G: 0.11% |
| Indica Intermediate | 786 | 50.40% | 10.70% | 18.32% | 20.61% | NA |
| Temperate Japonica | 767 | 70.50% | 0.50% | 12.91% | 16.04% | NA |
| Tropical Japonica | 504 | 35.50% | 1.60% | 32.34% | 30.36% | G: 0.20% |
| Japonica Intermediate | 241 | 46.50% | 2.10% | 28.22% | 23.24% | NA |
| VI/Aromatic | 96 | 39.60% | 11.50% | 38.54% | 10.42% | NA |
| Intermediate | 90 | 52.20% | 7.80% | 24.44% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208274233 | T -> C | LOC_Os12g14480.1 | upstream_gene_variant ; 4108.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> C | LOC_Os12g14500.1 | upstream_gene_variant ; 4040.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> C | LOC_Os12g14490.1 | downstream_gene_variant ; 127.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> C | LOC_Os12g14490-LOC_Os12g14500 | intergenic_region ; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> DEL | N | N | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> G | LOC_Os12g14480.1 | upstream_gene_variant ; 4108.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> G | LOC_Os12g14500.1 | upstream_gene_variant ; 4040.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> G | LOC_Os12g14490.1 | downstream_gene_variant ; 127.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1208274233 | T -> G | LOC_Os12g14490-LOC_Os12g14500 | intergenic_region ; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208274233 | 3.29E-06 | NA | mr1102_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208274233 | 6.20E-06 | 6.20E-06 | mr1430_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208274233 | NA | 3.56E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208274233 | 6.05E-07 | 6.05E-07 | mr1562_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |