\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208274233:

Variant ID: vg1208274233 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8274233
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACGTCTGCTGCCGACTGTGCCCTCGCCTCTACGGTTGGTTTATACTGCTACCTCTATTGATGGACGTCATCGTTTTCATTGCTGGCCGCCTTGTCTGA[T/C,G]
GCCGACTGGCTTGTTCACCTCCACGGCTGCGCGCCTTCGTCATCATTGACTGGCGTCATCGTCATCATCGGTTTGCCTTCGCCGCCGTCCATGGTGTCTT

Reverse complement sequence

AAGACACCATGGACGGCGGCGAAGGCAAACCGATGATGACGATGACGCCAGTCAATGATGACGAAGGCGCGCAGCCGTGGAGGTGAACAAGCCAGTCGGC[A/G,C]
TCAGACAAGGCGGCCAGCAATGAAAACGATGACGTCCATCAATAGAGGTAGCAGTATAAACCAACCGTAGAGGCGAGGGCACAGTCGGCAGCAGACGTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 6.70% 20.52% 22.41% G: 0.04%
All Indica  2759 50.10% 10.10% 18.05% 21.71% G: 0.04%
All Japonica  1512 55.00% 1.10% 21.83% 21.96% G: 0.07%
Aus  269 28.60% 1.90% 30.86% 38.66% NA
Indica I  595 40.00% 5.50% 17.31% 37.14% NA
Indica II  465 47.10% 10.50% 21.72% 20.65% NA
Indica III  913 58.10% 12.30% 16.43% 13.14% G: 0.11%
Indica Intermediate  786 50.40% 10.70% 18.32% 20.61% NA
Temperate Japonica  767 70.50% 0.50% 12.91% 16.04% NA
Tropical Japonica  504 35.50% 1.60% 32.34% 30.36% G: 0.20%
Japonica Intermediate  241 46.50% 2.10% 28.22% 23.24% NA
VI/Aromatic  96 39.60% 11.50% 38.54% 10.42% NA
Intermediate  90 52.20% 7.80% 24.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208274233 T -> C LOC_Os12g14480.1 upstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> C LOC_Os12g14500.1 upstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> C LOC_Os12g14490.1 downstream_gene_variant ; 127.0bp to feature; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> C LOC_Os12g14490-LOC_Os12g14500 intergenic_region ; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> DEL N N silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> G LOC_Os12g14480.1 upstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> G LOC_Os12g14500.1 upstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> G LOC_Os12g14490.1 downstream_gene_variant ; 127.0bp to feature; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1208274233 T -> G LOC_Os12g14490-LOC_Os12g14500 intergenic_region ; MODIFIER silent_mutation Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208274233 3.29E-06 NA mr1102_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208274233 6.20E-06 6.20E-06 mr1430_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208274233 NA 3.56E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208274233 6.05E-07 6.05E-07 mr1562_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251