Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1208274233:

Variant ID: vg1208274233 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8274233
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACGTCTGCTGCCGACTGTGCCCTCGCCTCTACGGTTGGTTTATACTGCTACCTCTATTGATGGACGTCATCGTTTTCATTGCTGGCCGCCTTGTCTGA[T/C,G]
GCCGACTGGCTTGTTCACCTCCACGGCTGCGCGCCTTCGTCATCATTGACTGGCGTCATCGTCATCATCGGTTTGCCTTCGCCGCCGTCCATGGTGTCTT

Reverse complement sequence

AAGACACCATGGACGGCGGCGAAGGCAAACCGATGATGACGATGACGCCAGTCAATGATGACGAAGGCGCGCAGCCGTGGAGGTGAACAAGCCAGTCGGC[A/G,C]
TCAGACAAGGCGGCCAGCAATGAAAACGATGACGTCCATCAATAGAGGTAGCAGTATAAACCAACCGTAGAGGCGAGGGCACAGTCGGCAGCAGACGTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	6.70%	20.52%	22.41%	G: 0.04%
All Indica	2759	50.10%	10.10%	18.05%	21.71%	G: 0.04%
All Japonica	1512	55.00%	1.10%	21.83%	21.96%	G: 0.07%
Aus	269	28.60%	1.90%	30.86%	38.66%	NA
Indica I	595	40.00%	5.50%	17.31%	37.14%	NA
Indica II	465	47.10%	10.50%	21.72%	20.65%	NA
Indica III	913	58.10%	12.30%	16.43%	13.14%	G: 0.11%
Indica Intermediate	786	50.40%	10.70%	18.32%	20.61%	NA
Temperate Japonica	767	70.50%	0.50%	12.91%	16.04%	NA
Tropical Japonica	504	35.50%	1.60%	32.34%	30.36%	G: 0.20%
Japonica Intermediate	241	46.50%	2.10%	28.22%	23.24%	NA
VI/Aromatic	96	39.60%	11.50%	38.54%	10.42%	NA
Intermediate	90	52.20%	7.80%	24.44%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208274233	T -> C	LOC_Os12g14480.1	upstream_gene_variant ; 4108.0bp to feature; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> C	LOC_Os12g14500.1	upstream_gene_variant ; 4040.0bp to feature; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> C	LOC_Os12g14490.1	downstream_gene_variant ; 127.0bp to feature; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> C	LOC_Os12g14490-LOC_Os12g14500	intergenic_region ; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> DEL	N	N	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> G	LOC_Os12g14480.1	upstream_gene_variant ; 4108.0bp to feature; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> G	LOC_Os12g14500.1	upstream_gene_variant ; 4040.0bp to feature; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> G	LOC_Os12g14490.1	downstream_gene_variant ; 127.0bp to feature; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1208274233	T -> G	LOC_Os12g14490-LOC_Os12g14500	intergenic_region ; MODIFIER	silent_mutation	Average:43.402; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208274233	3.29E-06	NA	mr1102_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208274233	6.20E-06	6.20E-06	mr1430_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208274233	NA	3.56E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208274233	6.05E-07	6.05E-07	mr1562_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251