Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208272715:

Variant ID: vg1208272715 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8272715
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGATATTTTCCTTTTCCTCTGCCTCACTACATCAACTGGTTCGTCGTTGATGAGTGAGTCGGGGGCTACAGATGTTATATCATATTTTCAACAATTTTC[A/G]
TAATATTTATCTTGATTGCTTGCGATATAATCTGAGTACAAAAGTGCCTATCGAGTTATAGAGTTCTATCTTCCTACGCTTTCCTTTTGGTTTGTCAATG

Reverse complement sequence

CATTGACAAACCAAAAGGAAAGCGTAGGAAGATAGAACTCTATAACTCGATAGGCACTTTTGTACTCAGATTATATCGCAAGCAATCAAGATAAATATTA[T/C]
GAAAATTGTTGAAAATATGATATAACATCTGTAGCCCCCGACTCACTCATCAACGACGAACCAGTTGATGTAGTGAGGCAGAGGAAAAGGAAAATATCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	1.80%	5.40%	15.19%	NA
All Indica	2759	88.60%	2.00%	6.34%	3.01%	NA
All Japonica	1512	55.20%	1.60%	3.90%	39.29%	NA
Aus	269	85.50%	0.00%	3.35%	11.15%	NA
Indica I	595	84.20%	0.20%	8.40%	7.23%	NA
Indica II	465	85.20%	3.40%	9.25%	2.15%	NA
Indica III	913	93.60%	2.60%	3.07%	0.66%	NA
Indica Intermediate	786	88.20%	1.90%	6.87%	3.05%	NA
Temperate Japonica	767	73.30%	0.80%	2.48%	23.47%	NA
Tropical Japonica	504	32.10%	2.00%	4.76%	61.11%	NA
Japonica Intermediate	241	46.10%	3.30%	6.64%	43.98%	NA
VI/Aromatic	96	87.50%	2.10%	6.25%	4.17%	NA
Intermediate	90	84.40%	1.10%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208272715	A -> DEL	N	N	silent_mutation	Average:38.038; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N
vg1208272715	A -> G	LOC_Os12g14480.1	upstream_gene_variant ; 2590.0bp to feature; MODIFIER	silent_mutation	Average:38.038; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N
vg1208272715	A -> G	LOC_Os12g14490.1	intron_variant ; MODIFIER	silent_mutation	Average:38.038; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208272715	1.46E-06	8.94E-09	mr1750_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251