Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208270538:

Variant ID: vg1208270538 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8270538
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATATGTAACAGATCATGACTTAGGTATTACGTTTCCTTGTATATTATGGAACGGCATGGAGTCCTGGTTTGATAATATTATAAAGTAGATTTAGGAA[T/A]
CCGATACTGTATTGGTTAAGGTTTCTATCCTGTAATCCTGCCCCCATCCTGTATAAGGTGAGCCGGAGGCCCTTTAAGGGGCATGAGACAACTAGATCGT

Reverse complement sequence

ACGATCTAGTTGTCTCATGCCCCTTAAAGGGCCTCCGGCTCACCTTATACAGGATGGGGGCAGGATTACAGGATAGAAACCTTAACCAATACAGTATCGG[A/T]
TTCCTAAATCTACTTTATAATATTATCAAACCAGGACTCCATGCCGTTCCATAATATACAAGGAAACGTAATACCTAAGTCATGATCTGTTACATATTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.00% 17.90% 0.51% 53.60% NA
All Indica  2759 46.20% 4.60% 0.43% 48.82% NA
All Japonica  1512 1.50% 41.60% 0.60% 56.28% NA
Aus  269 2.20% 16.40% 0.00% 81.41% NA
Indica I  595 30.30% 8.70% 0.67% 60.34% NA
Indica II  465 39.10% 6.20% 0.65% 53.98% NA
Indica III  913 59.10% 0.80% 0.00% 40.09% NA
Indica Intermediate  786 47.30% 4.80% 0.64% 47.20% NA
Temperate Japonica  767 0.70% 66.10% 0.65% 32.59% NA
Tropical Japonica  504 3.40% 10.90% 0.79% 84.92% NA
Japonica Intermediate  241 0.40% 27.80% 0.00% 71.78% NA
VI/Aromatic  96 2.10% 20.80% 0.00% 77.08% NA
Intermediate  90 22.20% 27.80% 3.33% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208270538 T -> DEL N N silent_mutation Average:28.737; most accessible tissue: Callus, score: 63.017 N N N N
vg1208270538 T -> A LOC_Os12g14480.1 upstream_gene_variant ; 413.0bp to feature; MODIFIER silent_mutation Average:28.737; most accessible tissue: Callus, score: 63.017 N N N N
vg1208270538 T -> A LOC_Os12g14490.1 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:28.737; most accessible tissue: Callus, score: 63.017 N N N N
vg1208270538 T -> A LOC_Os12g14480-LOC_Os12g14490 intergenic_region ; MODIFIER silent_mutation Average:28.737; most accessible tissue: Callus, score: 63.017 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208270538 NA 1.86E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208270538 NA 1.73E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208270538 NA 1.81E-11 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 9.27E-07 3.80E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 8.22E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 5.16E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.35E-06 mr1031 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 7.79E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 3.85E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 8.97E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.26E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 7.79E-06 1.73E-16 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 1.01E-10 9.41E-22 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.39E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 2.86E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.82E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.44E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 2.81E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 5.74E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 8.52E-06 3.01E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.82E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.57E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.87E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.54E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 2.77E-06 1.20E-06 mr1332_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.86E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 9.88E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 3.04E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 7.67E-07 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 2.84E-06 1.11E-07 mr1474_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.82E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 3.30E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 8.92E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 5.84E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 3.52E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 7.98E-07 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 7.35E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 7.19E-06 7.19E-06 mr1690_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 9.75E-09 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 2.30E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 2.14E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 4.40E-06 3.30E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 2.37E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 1.44E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 NA 4.91E-06 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270538 3.21E-07 3.21E-07 mr1991_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251