\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208270520:

Variant ID: vg1208270520 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8270520
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


GGGATAACTTATATCTATGAAATATGTAACAGATCATGACTTAGGTATTACGTTTCCTTGTATATTATGGAACGGCATGGAGTCCTGGTTTGATAATATT[A/G]
TAAAGTAGATTTAGGAATCCGATACTGTATTGGTTAAGGTTTCTATCCTGTAATCCTGCCCCCATCCTGTATAAGGTGAGCCGGAGGCCCTTTAAGGGGC

Reverse complement sequence

GCCCCTTAAAGGGCCTCCGGCTCACCTTATACAGGATGGGGGCAGGATTACAGGATAGAAACCTTAACCAATACAGTATCGGATTCCTAAATCTACTTTA[T/C]
AATATTATCAAACCAGGACTCCATGCCGTTCCATAATATACAAGGAAACGTAATACCTAAGTCATGATCTGTTACATATTTCATAGATATAAGTTATCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.90% 19.20% 1.12% 53.70% NA
All Indica  2759 42.80% 6.30% 1.23% 49.66% NA
All Japonica  1512 1.50% 42.20% 0.93% 55.42% NA
Aus  269 2.20% 17.50% 0.00% 80.30% NA
Indica I  595 28.70% 8.20% 1.51% 61.51% NA
Indica II  465 37.20% 7.50% 1.29% 53.98% NA
Indica III  913 55.30% 2.10% 0.77% 41.84% NA
Indica Intermediate  786 42.20% 9.00% 1.53% 47.20% NA
Temperate Japonica  767 0.70% 66.60% 0.78% 31.94% NA
Tropical Japonica  504 3.40% 11.70% 0.79% 84.13% NA
Japonica Intermediate  241 0.00% 28.20% 1.66% 70.12% NA
VI/Aromatic  96 2.10% 20.80% 1.04% 76.04% NA
Intermediate  90 16.70% 33.30% 4.44% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208270520 A -> DEL N N silent_mutation Average:30.559; most accessible tissue: Callus, score: 63.017 N N N N
vg1208270520 A -> G LOC_Os12g14480.1 upstream_gene_variant ; 395.0bp to feature; MODIFIER silent_mutation Average:30.559; most accessible tissue: Callus, score: 63.017 N N N N
vg1208270520 A -> G LOC_Os12g14490.1 upstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:30.559; most accessible tissue: Callus, score: 63.017 N N N N
vg1208270520 A -> G LOC_Os12g14480-LOC_Os12g14490 intergenic_region ; MODIFIER silent_mutation Average:30.559; most accessible tissue: Callus, score: 63.017 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208270520 NA 2.26E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 2.92E-10 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 2.58E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 1.18E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 2.75E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 4.12E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 3.82E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 5.07E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 7.63E-12 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 8.55E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 3.93E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 6.02E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 1.00E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 5.31E-06 2.70E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 9.45E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 1.23E-06 NA mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 9.46E-07 1.68E-09 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 9.11E-07 NA mr1732_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 1.06E-06 5.18E-09 mr1732_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 1.86E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 2.65E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208270520 NA 2.82E-06 mr1994_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251