\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208263364:

Variant ID: vg1208263364 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8263364
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACTTTTAATATATTATAGGTGTCAGTTAATTAAAACCAACCCCTATAATATATTTTAGATGCTGGTTTTCTAAAAAAAACCCAACACCTTTCAAAATC[G/A]
AGCCAAGTCAGTAGATGGGTTTTCCTTTTTTTTAGCGCAAAGGGGGGGCGAGATGGAGCTTATCCACTCGCTTCGCCCCCTCTCGCCCGTCTTTTTTCTC

Reverse complement sequence

GAGAAAAAAGACGGGCGAGAGGGGGCGAAGCGAGTGGATAAGCTCCATCTCGCCCCCCCTTTGCGCTAAAAAAAAGGAAAACCCATCTACTGACTTGGCT[C/T]
GATTTTGAAAGGTGTTGGGTTTTTTTTAGAAAACCAGCATCTAAAATATATTATAGGGGTTGGTTTTAATTAACTGACACCTATAATATATTAAAAGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 18.00% 10.73% 17.10% NA
All Indica  2759 60.10% 0.70% 16.75% 22.51% NA
All Japonica  1512 44.00% 52.80% 1.32% 1.79% NA
Aus  269 48.00% 0.70% 2.23% 49.07% NA
Indica I  595 46.70% 0.50% 28.07% 24.71% NA
Indica II  465 59.40% 0.60% 19.57% 20.43% NA
Indica III  913 69.20% 0.40% 9.42% 20.92% NA
Indica Intermediate  786 60.10% 1.00% 15.01% 23.92% NA
Temperate Japonica  767 68.40% 26.90% 1.69% 3.00% NA
Tropical Japonica  504 14.90% 84.30% 0.40% 0.40% NA
Japonica Intermediate  241 27.40% 69.70% 2.07% 0.83% NA
VI/Aromatic  96 58.30% 6.20% 14.58% 20.83% NA
Intermediate  90 58.90% 26.70% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208263364 G -> DEL N N silent_mutation Average:37.618; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg1208263364 G -> A LOC_Os12g14480.1 downstream_gene_variant ; 2949.0bp to feature; MODIFIER silent_mutation Average:37.618; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg1208263364 G -> A LOC_Os12g14470-LOC_Os12g14480 intergenic_region ; MODIFIER silent_mutation Average:37.618; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208263364 NA 6.01E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208263364 1.09E-06 8.28E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 3.75E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 3.25E-06 9.09E-14 mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 9.17E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 1.46E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 2.67E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 1.93E-06 5.39E-13 mr1056 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 1.38E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 1.58E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 7.68E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 7.78E-08 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 5.89E-08 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 4.96E-06 mr1558 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 1.46E-06 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 6.50E-10 2.68E-20 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 7.36E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 1.19E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 2.78E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 4.90E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 4.31E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 5.45E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 6.13E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208263364 NA 5.88E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251