Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1208230184:

Variant ID: vg1208230184 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8230184
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTCCTCAATGATGAGAATGCAACCATACCTACACACAAGCAAACAAAAGCGTTCTACCCTACTAACTATACTTCAAAGTCACTTTGGCGGTTTAAGTT[C/G]
TAAGGTAGGATCCAAACTTCATTCCTTCTTGACAACTGGACACTTCAGATCGATCATCACCTTCATATTCCTCGATCCACTTGATAAGTAGACCACATTG

Reverse complement sequence

CAATGTGGTCTACTTATCAAGTGGATCGAGGAATATGAAGGTGATGATCGATCTGAAGTGTCCAGTTGTCAAGAAGGAATGAAGTTTGGATCCTACCTTA[G/C]
AACTTAAACCGCCAAAGTGACTTTGAAGTATAGTTAGTAGGGTAGAACGCTTTTGTTTGCTTGTGTGTAGGTATGGTTGCATTCTCATCATTGAGGAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	22.50%	12.00%	5.90%	NA
All Indica	2759	58.50%	34.60%	6.81%	0.14%	NA
All Japonica	1512	54.40%	4.00%	23.68%	17.92%	NA
Aus	269	95.90%	0.40%	3.35%	0.37%	NA
Indica I	595	42.50%	46.40%	10.92%	0.17%	NA
Indica II	465	45.40%	49.70%	4.73%	0.22%	NA
Indica III	913	73.50%	20.90%	5.59%	0.00%	NA
Indica Intermediate	786	60.80%	32.60%	6.36%	0.25%	NA
Temperate Japonica	767	76.70%	6.30%	12.26%	4.82%	NA
Tropical Japonica	504	25.60%	1.40%	30.36%	42.66%	NA
Japonica Intermediate	241	43.60%	2.50%	46.06%	7.88%	NA
VI/Aromatic	96	61.50%	37.50%	1.04%	0.00%	NA
Intermediate	90	74.40%	10.00%	12.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208230184	C -> DEL	N	N	silent_mutation	Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 76.773	N	N	N	N
vg1208230184	C -> G	LOC_Os12g14430.1	upstream_gene_variant ; 251.0bp to feature; MODIFIER	silent_mutation	Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 76.773	N	N	N	N
vg1208230184	C -> G	LOC_Os12g14430-LOC_Os12g14440	intergenic_region ; MODIFIER	silent_mutation	Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 76.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208230184	NA	6.20E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208230184	NA	6.03E-09	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208230184	NA	7.07E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208230184	NA	2.80E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208230184	1.28E-07	1.64E-08	mr1350_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208230184	NA	1.01E-09	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251