| Variant ID: vg1208226889 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8226889 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.33, others allele: 0.00, population size: 94. )
AACAAGCAACTGGGTTAAATAAGTATGGGTAAAATGGACTATTTACGCCTAAATTAACACCGTTAACTCATCCAAACGGAATATGGTCAGACCAGTGCTT[C/T]
GTTTTTTAAAAGGAGGGTCAAATAAGCACATTTTAAAAAGCAGGGTTAAATTGGTAGTTACAGTTCAAAACAGGGTCAAATAAGCAATTGCCCCTTAGTT
AACTAAGGGGCAATTGCTTATTTGACCCTGTTTTGAACTGTAACTACCAATTTAACCCTGCTTTTTAAAATGTGCTTATTTGACCCTCCTTTTAAAAAAC[G/A]
AAGCACTGGTCTGACCATATTCCGTTTGGATGAGTTAACGGTGTTAATTTAGGCGTAAATAGTCCATTTTACCCATACTTATTTAACCCAGTTGCTTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 27.20% | 7.09% | 15.45% | NA |
| All Indica | 2759 | 49.40% | 38.20% | 0.36% | 12.00% | NA |
| All Japonica | 1512 | 58.70% | 4.40% | 20.90% | 16.01% | NA |
| Aus | 269 | 20.40% | 30.10% | 0.37% | 49.07% | NA |
| Indica I | 595 | 36.80% | 47.70% | 0.34% | 15.13% | NA |
| Indica II | 465 | 41.50% | 51.00% | 0.43% | 7.10% | NA |
| Indica III | 913 | 60.50% | 27.50% | 0.22% | 11.83% | NA |
| Indica Intermediate | 786 | 50.80% | 36.00% | 0.51% | 12.72% | NA |
| Temperate Japonica | 767 | 72.40% | 6.40% | 11.08% | 10.17% | NA |
| Tropical Japonica | 504 | 40.90% | 2.00% | 32.14% | 25.00% | NA |
| Japonica Intermediate | 241 | 52.30% | 3.30% | 28.63% | 15.77% | NA |
| VI/Aromatic | 96 | 22.90% | 67.70% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 53.30% | 20.00% | 7.78% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208226889 | C -> DEL | N | N | silent_mutation | Average:55.364; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1208226889 | C -> T | LOC_Os12g14430.1 | downstream_gene_variant ; 1944.0bp to feature; MODIFIER | silent_mutation | Average:55.364; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1208226889 | C -> T | LOC_Os12g14420-LOC_Os12g14430 | intergenic_region ; MODIFIER | silent_mutation | Average:55.364; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208226889 | NA | 6.93E-07 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226889 | NA | 2.31E-08 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226889 | NA | 2.47E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226889 | NA | 6.97E-06 | mr1040_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226889 | 3.93E-06 | 2.73E-07 | mr1091_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226889 | NA | 5.91E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226889 | 6.16E-06 | 9.46E-07 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226889 | NA | 1.68E-09 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |