| Variant ID: vg1208226149 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8226149 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 81. )
TAAATCTGCTCTTTATGTCAAGATATTATTGCATCTACGTATATTAAGCTTCGGTTTGGTATATTCTGCTTGTTTTAATATCTTAACATAGAGCTGTATC[G/A]
GAGTATTAGCCGATACATGCTAGATCTATCTGATCGGATTTGCTGTAAACATATATAGTTCTATTATTAATATATATTTCGATCTAAGTGATTTATACTG
CAGTATAAATCACTTAGATCGAAATATATATTAATAATAGAACTATATATGTTTACAGCAAATCCGATCAGATAGATCTAGCATGTATCGGCTAATACTC[C/T]
GATACAGCTCTATGTTAAGATATTAAAACAAGCAGAATATACCAAACCGAAGCTTAATATACGTAGATGCAATAATATCTTGACATAAAGAGCAGATTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.50% | 26.40% | 1.12% | 25.96% | NA |
| All Indica | 2759 | 49.90% | 37.90% | 0.54% | 11.63% | NA |
| All Japonica | 1512 | 45.80% | 4.50% | 1.79% | 47.95% | NA |
| Aus | 269 | 21.60% | 30.10% | 2.97% | 45.35% | NA |
| Indica I | 595 | 37.10% | 47.40% | 0.34% | 15.13% | NA |
| Indica II | 465 | 42.20% | 50.80% | 0.00% | 7.10% | NA |
| Indica III | 913 | 60.60% | 27.50% | 0.88% | 11.06% | NA |
| Indica Intermediate | 786 | 51.70% | 35.40% | 0.64% | 12.34% | NA |
| Temperate Japonica | 767 | 69.20% | 6.40% | 0.65% | 23.73% | NA |
| Tropical Japonica | 504 | 16.30% | 2.00% | 2.98% | 78.77% | NA |
| Japonica Intermediate | 241 | 32.80% | 3.70% | 2.90% | 60.58% | NA |
| VI/Aromatic | 96 | 25.00% | 37.50% | 1.04% | 36.46% | NA |
| Intermediate | 90 | 52.20% | 18.90% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208226149 | G -> DEL | N | N | silent_mutation | Average:34.314; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg1208226149 | G -> A | LOC_Os12g14420.1 | downstream_gene_variant ; 4732.0bp to feature; MODIFIER | silent_mutation | Average:34.314; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg1208226149 | G -> A | LOC_Os12g14430.1 | downstream_gene_variant ; 2684.0bp to feature; MODIFIER | silent_mutation | Average:34.314; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg1208226149 | G -> A | LOC_Os12g14420-LOC_Os12g14430 | intergenic_region ; MODIFIER | silent_mutation | Average:34.314; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208226149 | NA | 2.21E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | NA | 3.41E-08 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | NA | 1.19E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | NA | 8.58E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | NA | 1.11E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | NA | 1.41E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | NA | 5.63E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | 4.63E-06 | 4.63E-06 | mr1581_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208226149 | NA | 3.36E-09 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |