\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208207975:

Variant ID: vg1208207975 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8207975
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCACCATCTGTCGAAGTTTCTGCTCTTGAATCCCGCCAACTCAATGTTGTCAATGCTGCCTAGAGGGGGTCCTGGGAGGTTAAGCAGCCGATCCATCA[T/C]
CAGCGTTGATGTGATTTCTCCTCGGCACTGGATCTTGTCGGCAAAGAATAAGCCGATTGGGAGTTGGCCTAATCCAAGTTGTCTAGCCGAGCTCATTGGG

Reverse complement sequence

CCCAATGAGCTCGGCTAGACAACTTGGATTAGGCCAACTCCCAATCGGCTTATTCTTTGCCGACAAGATCCAGTGCCGAGGAGAAATCACATCAACGCTG[A/G]
TGATGGATCGGCTGCTTAACCTCCCAGGACCCCCTCTAGGCAGCATTGACAACATTGAGTTGGCGGGATTCAAGAGCAGAAACTTCGACAGATGGTGGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 25.40% 1.97% 22.94% NA
All Indica  2759 51.20% 36.50% 1.16% 11.16% NA
All Japonica  1512 53.10% 4.40% 1.79% 40.74% NA
Aus  269 21.90% 28.60% 11.90% 37.55% NA
Indica I  595 39.70% 45.90% 0.34% 14.12% NA
Indica II  465 42.60% 50.10% 0.65% 6.67% NA
Indica III  913 61.60% 26.00% 1.20% 11.28% NA
Indica Intermediate  786 53.10% 33.50% 2.04% 11.45% NA
Temperate Japonica  767 74.80% 6.40% 1.69% 17.08% NA
Tropical Japonica  504 24.20% 2.00% 2.18% 71.63% NA
Japonica Intermediate  241 44.40% 2.90% 1.24% 51.45% NA
VI/Aromatic  96 21.90% 35.40% 2.08% 40.62% NA
Intermediate  90 58.90% 18.90% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208207975 T -> C LOC_Os12g14400.1 upstream_gene_variant ; 3301.0bp to feature; MODIFIER silent_mutation Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1208207975 T -> C LOC_Os12g14374.1 downstream_gene_variant ; 3000.0bp to feature; MODIFIER silent_mutation Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1208207975 T -> C LOC_Os12g14390.1 intron_variant ; MODIFIER silent_mutation Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg1208207975 T -> DEL N N silent_mutation Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208207975 2.38E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 2.40E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 NA 5.92E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 3.57E-06 NA mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 NA 2.87E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 NA 9.98E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 NA 1.23E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 NA 3.88E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975 NA 2.68E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251