\
| Variant ID: vg1208207975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8207975 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 92. )
CCCCACCATCTGTCGAAGTTTCTGCTCTTGAATCCCGCCAACTCAATGTTGTCAATGCTGCCTAGAGGGGGTCCTGGGAGGTTAAGCAGCCGATCCATCA[T/C]
CAGCGTTGATGTGATTTCTCCTCGGCACTGGATCTTGTCGGCAAAGAATAAGCCGATTGGGAGTTGGCCTAATCCAAGTTGTCTAGCCGAGCTCATTGGG
CCCAATGAGCTCGGCTAGACAACTTGGATTAGGCCAACTCCCAATCGGCTTATTCTTTGCCGACAAGATCCAGTGCCGAGGAGAAATCACATCAACGCTG[A/G]
TGATGGATCGGCTGCTTAACCTCCCAGGACCCCCTCTAGGCAGCATTGACAACATTGAGTTGGCGGGATTCAAGAGCAGAAACTTCGACAGATGGTGGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 25.40% | 1.97% | 22.94% | NA |
| All Indica | 2759 | 51.20% | 36.50% | 1.16% | 11.16% | NA |
| All Japonica | 1512 | 53.10% | 4.40% | 1.79% | 40.74% | NA |
| Aus | 269 | 21.90% | 28.60% | 11.90% | 37.55% | NA |
| Indica I | 595 | 39.70% | 45.90% | 0.34% | 14.12% | NA |
| Indica II | 465 | 42.60% | 50.10% | 0.65% | 6.67% | NA |
| Indica III | 913 | 61.60% | 26.00% | 1.20% | 11.28% | NA |
| Indica Intermediate | 786 | 53.10% | 33.50% | 2.04% | 11.45% | NA |
| Temperate Japonica | 767 | 74.80% | 6.40% | 1.69% | 17.08% | NA |
| Tropical Japonica | 504 | 24.20% | 2.00% | 2.18% | 71.63% | NA |
| Japonica Intermediate | 241 | 44.40% | 2.90% | 1.24% | 51.45% | NA |
| VI/Aromatic | 96 | 21.90% | 35.40% | 2.08% | 40.62% | NA |
| Intermediate | 90 | 58.90% | 18.90% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208207975 | T -> C | LOC_Os12g14400.1 | upstream_gene_variant ; 3301.0bp to feature; MODIFIER | silent_mutation | Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg1208207975 | T -> C | LOC_Os12g14374.1 | downstream_gene_variant ; 3000.0bp to feature; MODIFIER | silent_mutation | Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg1208207975 | T -> C | LOC_Os12g14390.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg1208207975 | T -> DEL | N | N | silent_mutation | Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208207975 | 2.38E-06 | NA | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | 2.40E-06 | NA | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | NA | 5.92E-09 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | 3.57E-06 | NA | mr1560 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | NA | 2.87E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | NA | 9.98E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | NA | 1.23E-06 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | NA | 3.88E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208207975 | NA | 2.68E-09 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |