Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208207975:

Variant ID: vg1208207975 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8207975
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CCCCACCATCTGTCGAAGTTTCTGCTCTTGAATCCCGCCAACTCAATGTTGTCAATGCTGCCTAGAGGGGGTCCTGGGAGGTTAAGCAGCCGATCCATCA[T/C]
CAGCGTTGATGTGATTTCTCCTCGGCACTGGATCTTGTCGGCAAAGAATAAGCCGATTGGGAGTTGGCCTAATCCAAGTTGTCTAGCCGAGCTCATTGGG

Reverse complement sequence

CCCAATGAGCTCGGCTAGACAACTTGGATTAGGCCAACTCCCAATCGGCTTATTCTTTGCCGACAAGATCCAGTGCCGAGGAGAAATCACATCAACGCTG[A/G]
TGATGGATCGGCTGCTTAACCTCCCAGGACCCCCTCTAGGCAGCATTGACAACATTGAGTTGGCGGGATTCAAGAGCAGAAACTTCGACAGATGGTGGGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	25.40%	1.97%	22.94%	NA
All Indica	2759	51.20%	36.50%	1.16%	11.16%	NA
All Japonica	1512	53.10%	4.40%	1.79%	40.74%	NA
Aus	269	21.90%	28.60%	11.90%	37.55%	NA
Indica I	595	39.70%	45.90%	0.34%	14.12%	NA
Indica II	465	42.60%	50.10%	0.65%	6.67%	NA
Indica III	913	61.60%	26.00%	1.20%	11.28%	NA
Indica Intermediate	786	53.10%	33.50%	2.04%	11.45%	NA
Temperate Japonica	767	74.80%	6.40%	1.69%	17.08%	NA
Tropical Japonica	504	24.20%	2.00%	2.18%	71.63%	NA
Japonica Intermediate	241	44.40%	2.90%	1.24%	51.45%	NA
VI/Aromatic	96	21.90%	35.40%	2.08%	40.62%	NA
Intermediate	90	58.90%	18.90%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208207975	T -> C	LOC_Os12g14400.1	upstream_gene_variant ; 3301.0bp to feature; MODIFIER	silent_mutation	Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1208207975	T -> C	LOC_Os12g14374.1	downstream_gene_variant ; 3000.0bp to feature; MODIFIER	silent_mutation	Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1208207975	T -> C	LOC_Os12g14390.1	intron_variant ; MODIFIER	silent_mutation	Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg1208207975	T -> DEL	N	N	silent_mutation	Average:57.629; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208207975	2.38E-06	NA	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	2.40E-06	NA	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	NA	5.92E-09	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	3.57E-06	NA	mr1560	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	NA	2.87E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	NA	9.98E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	NA	1.23E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	NA	3.88E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208207975	NA	2.68E-09	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251