\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208174078:

Variant ID: vg1208174078 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8174078
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.35, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTTCCTCTGTTCTTAATTAGTGTACAGATTGAAACCACAGGGGGAAAAAAAACAGAGGATGGACTCAAGAAAAGAGGGAAGCTGATTGCCATCTTCC[C/T]
AGAAATGCCAGGTTCAGGCCTTCAGGGTCATAACGTCCGGTGATTTCTATTACACGAGAAAACAGTGAAGCTGAGCAGGGGTGCAGTGGAACCGGAGGGA

Reverse complement sequence

TCCCTCCGGTTCCACTGCACCCCTGCTCAGCTTCACTGTTTTCTCGTGTAATAGAAATCACCGGACGTTATGACCCTGAAGGCCTGAACCTGGCATTTCT[G/A]
GGAAGATGGCAATCAGCTTCCCTCTTTTCTTGAGTCCATCCTCTGTTTTTTTTCCCCCTGTGGTTTCAATCTGTACACTAATTAAGAACAGAGGAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 23.30% 0.93% 31.85% NA
All Indica  2759 46.40% 6.50% 1.20% 45.96% NA
All Japonica  1512 49.00% 47.10% 0.33% 3.57% NA
Aus  269 3.00% 46.80% 1.12% 49.07% NA
Indica I  595 30.80% 8.90% 1.51% 58.82% NA
Indica II  465 39.10% 4.90% 2.37% 53.55% NA
Indica III  913 59.00% 4.90% 0.88% 35.16% NA
Indica Intermediate  786 47.80% 7.30% 0.64% 44.27% NA
Temperate Japonica  767 22.40% 71.60% 0.39% 5.61% NA
Tropical Japonica  504 82.90% 15.90% 0.00% 1.19% NA
Japonica Intermediate  241 62.70% 34.40% 0.83% 2.07% NA
VI/Aromatic  96 7.30% 49.00% 3.12% 40.62% NA
Intermediate  90 45.60% 41.10% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208174078 C -> DEL N N silent_mutation Average:35.43; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg1208174078 C -> T LOC_Os12g14350.1 upstream_gene_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:35.43; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg1208174078 C -> T LOC_Os12g14340.1 downstream_gene_variant ; 3364.0bp to feature; MODIFIER silent_mutation Average:35.43; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg1208174078 C -> T LOC_Os12g14360.1 downstream_gene_variant ; 1847.0bp to feature; MODIFIER silent_mutation Average:35.43; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg1208174078 C -> T LOC_Os12g14340-LOC_Os12g14350 intergenic_region ; MODIFIER silent_mutation Average:35.43; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208174078 NA 1.15E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208174078 NA 5.49E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208174078 2.21E-12 2.50E-15 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 7.63E-07 4.25E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 2.93E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 7.65E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 4.16E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 9.65E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 6.06E-06 4.01E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 2.79E-06 NA mr1322 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 6.05E-06 NA mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 1.65E-06 NA mr1326 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 6.12E-07 1.89E-06 mr1363 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 3.45E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 4.87E-06 NA mr1817 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 4.84E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 5.90E-06 3.39E-06 mr1952 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 2.47E-14 6.94E-22 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 9.96E-11 2.87E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 1.32E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 7.02E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 4.75E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 2.95E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 1.27E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 2.30E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 8.59E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 5.56E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 5.57E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 1.29E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 2.13E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208174078 NA 1.19E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251