\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208166494:

Variant ID: vg1208166494 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8166494
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCTAAGTTGTTCTACACTACATGTTAGGAATTTACAACGGAGCGTAGCAAGTTCTACCAAAAAGAAATAAATGAACATGATTTTTAATTCCTATATG[G/A]
AATTGACTCATTATATTGGTAAGGCCACCTCATCATTGTTTCACTTCTAAGATTCTTTGTTCCAACCTACATGCTTGTACGATCAATATGATGTTCAACT

Reverse complement sequence

AGTTGAACATCATATTGATCGTACAAGCATGTAGGTTGGAACAAAGAATCTTAGAAGTGAAACAATGATGAGGTGGCCTTACCAATATAATGAGTCAATT[C/T]
CATATAGGAATTAAAAATCATGTTCATTTATTTCTTTTTGGTAGAACTTGCTACGCTCCGTTGTAAATTCCTAACATGTAGTGTAGAACAACTTAGAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.10% 1.00% 3.47% 66.40% NA
All Indica  2759 13.80% 1.50% 4.20% 80.46% NA
All Japonica  1512 48.30% 0.40% 1.39% 49.93% NA
Aus  269 62.50% 0.00% 8.18% 29.37% NA
Indica I  595 13.30% 1.70% 4.20% 80.84% NA
Indica II  465 10.80% 0.90% 4.73% 83.66% NA
Indica III  913 12.70% 2.10% 4.27% 80.94% NA
Indica Intermediate  786 17.30% 1.10% 3.82% 77.74% NA
Temperate Japonica  767 72.50% 0.30% 0.65% 26.60% NA
Tropical Japonica  504 17.10% 0.40% 2.18% 80.36% NA
Japonica Intermediate  241 36.50% 0.80% 2.07% 60.58% NA
VI/Aromatic  96 56.20% 0.00% 2.08% 41.67% NA
Intermediate  90 46.70% 1.10% 3.33% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208166494 G -> DEL N N silent_mutation Average:8.515; most accessible tissue: Callus, score: 32.914 N N N N
vg1208166494 G -> A LOC_Os12g14340.1 upstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:8.515; most accessible tissue: Callus, score: 32.914 N N N N
vg1208166494 G -> A LOC_Os12g14330.1 downstream_gene_variant ; 1226.0bp to feature; MODIFIER silent_mutation Average:8.515; most accessible tissue: Callus, score: 32.914 N N N N
vg1208166494 G -> A LOC_Os12g14330-LOC_Os12g14340 intergenic_region ; MODIFIER silent_mutation Average:8.515; most accessible tissue: Callus, score: 32.914 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208166494 NA 5.80E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208166494 NA 6.29E-11 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208166494 NA 8.91E-06 mr1603 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208166494 7.73E-09 4.23E-15 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208166494 NA 3.06E-15 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208166494 NA 7.96E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208166494 5.18E-07 5.18E-07 mr1853_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208166494 NA 2.17E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251