\
| Variant ID: vg1208166494 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8166494 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTCTAAGTTGTTCTACACTACATGTTAGGAATTTACAACGGAGCGTAGCAAGTTCTACCAAAAAGAAATAAATGAACATGATTTTTAATTCCTATATG[G/A]
AATTGACTCATTATATTGGTAAGGCCACCTCATCATTGTTTCACTTCTAAGATTCTTTGTTCCAACCTACATGCTTGTACGATCAATATGATGTTCAACT
AGTTGAACATCATATTGATCGTACAAGCATGTAGGTTGGAACAAAGAATCTTAGAAGTGAAACAATGATGAGGTGGCCTTACCAATATAATGAGTCAATT[C/T]
CATATAGGAATTAAAAATCATGTTCATTTATTTCTTTTTGGTAGAACTTGCTACGCTCCGTTGTAAATTCCTAACATGTAGTGTAGAACAACTTAGAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.10% | 1.00% | 3.47% | 66.40% | NA |
| All Indica | 2759 | 13.80% | 1.50% | 4.20% | 80.46% | NA |
| All Japonica | 1512 | 48.30% | 0.40% | 1.39% | 49.93% | NA |
| Aus | 269 | 62.50% | 0.00% | 8.18% | 29.37% | NA |
| Indica I | 595 | 13.30% | 1.70% | 4.20% | 80.84% | NA |
| Indica II | 465 | 10.80% | 0.90% | 4.73% | 83.66% | NA |
| Indica III | 913 | 12.70% | 2.10% | 4.27% | 80.94% | NA |
| Indica Intermediate | 786 | 17.30% | 1.10% | 3.82% | 77.74% | NA |
| Temperate Japonica | 767 | 72.50% | 0.30% | 0.65% | 26.60% | NA |
| Tropical Japonica | 504 | 17.10% | 0.40% | 2.18% | 80.36% | NA |
| Japonica Intermediate | 241 | 36.50% | 0.80% | 2.07% | 60.58% | NA |
| VI/Aromatic | 96 | 56.20% | 0.00% | 2.08% | 41.67% | NA |
| Intermediate | 90 | 46.70% | 1.10% | 3.33% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208166494 | G -> DEL | N | N | silent_mutation | Average:8.515; most accessible tissue: Callus, score: 32.914 | N | N | N | N |
| vg1208166494 | G -> A | LOC_Os12g14340.1 | upstream_gene_variant ; 2987.0bp to feature; MODIFIER | silent_mutation | Average:8.515; most accessible tissue: Callus, score: 32.914 | N | N | N | N |
| vg1208166494 | G -> A | LOC_Os12g14330.1 | downstream_gene_variant ; 1226.0bp to feature; MODIFIER | silent_mutation | Average:8.515; most accessible tissue: Callus, score: 32.914 | N | N | N | N |
| vg1208166494 | G -> A | LOC_Os12g14330-LOC_Os12g14340 | intergenic_region ; MODIFIER | silent_mutation | Average:8.515; most accessible tissue: Callus, score: 32.914 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208166494 | NA | 5.80E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208166494 | NA | 6.29E-11 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208166494 | NA | 8.91E-06 | mr1603 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208166494 | 7.73E-09 | 4.23E-15 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208166494 | NA | 3.06E-15 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208166494 | NA | 7.96E-08 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208166494 | 5.18E-07 | 5.18E-07 | mr1853_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208166494 | NA | 2.17E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |