\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208149893:

Variant ID: vg1208149893 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8149893
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGTTTCTAACTAGTACTAAAGATGCTTTTTTAAGTATCGGTTGGTAACACCAACTGGAACTAAAGATGTTTCTTGGATTTAAACTTTTAGAATCGGTA[T/C]
TAAAACATCTTTAATATATGTTCTTAATCTAGTCGGGATATTTGTGTTTTGAGGTTTGGAATAAAAAATATTTTTTCTAGTAGTGTAACGGCCACTGATT

Reverse complement sequence

AATCAGTGGCCGTTACACTACTAGAAAAAATATTTTTTATTCCAAACCTCAAAACACAAATATCCCGACTAGATTAAGAACATATATTAAAGATGTTTTA[A/G]
TACCGATTCTAAAAGTTTAAATCCAAGAAACATCTTTAGTTCCAGTTGGTGTTACCAACCGATACTTAAAAAAGCATCTTTAGTACTAGTTAGAAACACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.80% 21.30% 0.32% 53.55% NA
All Indica  2759 38.10% 6.90% 0.40% 54.66% NA
All Japonica  1512 4.20% 43.30% 0.13% 52.38% NA
Aus  269 0.70% 32.30% 0.74% 66.17% NA
Indica I  595 48.60% 10.10% 0.67% 40.67% NA
Indica II  465 52.00% 6.50% 0.43% 41.08% NA
Indica III  913 25.70% 4.90% 0.00% 69.33% NA
Indica Intermediate  786 36.30% 6.90% 0.64% 56.23% NA
Temperate Japonica  767 6.30% 68.80% 0.00% 24.90% NA
Tropical Japonica  504 1.40% 11.70% 0.40% 86.51% NA
Japonica Intermediate  241 3.70% 27.80% 0.00% 68.46% NA
VI/Aromatic  96 40.60% 45.80% 0.00% 13.54% NA
Intermediate  90 16.70% 38.90% 0.00% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208149893 T -> C LOC_Os12g14310.1 upstream_gene_variant ; 4197.0bp to feature; MODIFIER silent_mutation Average:16.714; most accessible tissue: Callus, score: 38.695 N N N N
vg1208149893 T -> C LOC_Os12g14290-LOC_Os12g14310 intergenic_region ; MODIFIER silent_mutation Average:16.714; most accessible tissue: Callus, score: 38.695 N N N N
vg1208149893 T -> DEL N N silent_mutation Average:16.714; most accessible tissue: Callus, score: 38.695 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208149893 NA 2.82E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208149893 NA 3.49E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208149893 1.65E-11 1.14E-13 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 2.14E-06 1.03E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 8.41E-20 mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 8.38E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 3.22E-18 mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 2.49E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 5.65E-15 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 1.46E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 3.93E-18 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 3.16E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 6.61E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 2.15E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 9.97E-19 4.76E-23 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 4.63E-10 8.93E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 2.76E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 5.61E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 4.21E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 1.19E-20 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 6.87E-11 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 2.52E-18 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 4.10E-13 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 4.09E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 3.69E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 1.03E-16 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 7.40E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 8.82E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 3.84E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 5.93E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208149893 NA 1.99E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251