\
| Variant ID: vg1208143024 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8143024 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 89. )
CCGAGGACTAACTAGTTGGCCTGGTGCCGACGTAGACGCAGCAAGTGCGGGAGCCGATACCGGTGCCGTCGGCTGAGCTGATGGCGCATTGGGAGGAACT[G/A]
TTTGAACAGATGGCTGAGTATTGGTGATCAGAGGCCGATAATCTGGAAAGACACCTCCTTGCAAATAAACTGGGCCTGTAGCCTGATATTCAGCCATTGA
TCAATGGCTGAATATCAGGCTACAGGCCCAGTTTATTTGCAAGGAGGTGTCTTTCCAGATTATCGGCCTCTGATCACCAATACTCAGCCATCTGTTCAAA[C/T]
AGTTCCTCCCAATGCGCCATCAGCTCAGCCGACGGCACCGGTATCGGCTCCCGCACTTGCTGCGTCTACGTCGGCACCAGGCCAACTAGTTAGTCCTCGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.00% | 19.50% | 0.83% | 52.64% | NA |
| All Indica | 2759 | 37.90% | 7.40% | 0.80% | 53.82% | NA |
| All Japonica | 1512 | 4.30% | 43.50% | 0.73% | 51.46% | NA |
| Aus | 269 | 30.50% | 3.00% | 1.86% | 64.68% | NA |
| Indica I | 595 | 48.60% | 9.90% | 0.84% | 40.67% | NA |
| Indica II | 465 | 52.30% | 6.70% | 0.22% | 40.86% | NA |
| Indica III | 913 | 25.60% | 5.50% | 0.77% | 68.13% | NA |
| Indica Intermediate | 786 | 35.80% | 8.30% | 1.15% | 54.83% | NA |
| Temperate Japonica | 767 | 6.30% | 68.70% | 0.65% | 24.38% | NA |
| Tropical Japonica | 504 | 1.80% | 12.10% | 0.60% | 85.52% | NA |
| Japonica Intermediate | 241 | 3.30% | 29.00% | 1.24% | 66.39% | NA |
| VI/Aromatic | 96 | 66.70% | 20.80% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 20.00% | 35.60% | 1.11% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208143024 | G -> DEL | LOC_Os12g14290.1 | N | frameshift_variant | Average:37.197; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg1208143024 | G -> A | LOC_Os12g14290.1 | missense_variant ; p.Thr226Ile; MODERATE | nonsynonymous_codon ; T226I | Average:37.197; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | unknown | unknown | TOLERATED | 0.33 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208143024 | NA | 5.78E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | NA | 4.31E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | NA | 1.77E-06 | mr1011_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | 1.36E-06 | NA | mr1015_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | 2.67E-06 | 2.79E-08 | mr1015_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | NA | 2.16E-14 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | NA | 8.71E-07 | mr1031_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | NA | 2.56E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | NA | 1.15E-06 | mr1477_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208143024 | NA | 7.30E-09 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |