\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208133155:

Variant ID: vg1208133155 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8133155
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATAGGGCTCGGGGTCTATTTATACCCAAGAATTACAAGATATGTCCATATCGGACACGACTATTATCTCTAACAAACTCTAAGATACCATAAGTCTTT[G/A]
CGGCAGACTTTTGCCCACATTTATCTCTAAAGAATTTACATAAAATATCCTAATTAATAGATACAATTGCCTTCTTAGGACTCTATCCATGCGCGGCAAT

Reverse complement sequence

ATTGCCGCGCATGGATAGAGTCCTAAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTAAATTCTTTAGAGATAAATGTGGGCAAAAGTCTGCCG[C/T]
AAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTCGTGTCCGATATGGACATATCTTGTAATTCTTGGGTATAAATAGACCCCGAGCCCTATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.60% 2.80% 5.88% 63.73% NA
All Indica  2759 13.70% 0.60% 7.79% 77.89% NA
All Japonica  1512 44.60% 0.10% 2.25% 53.04% NA
Aus  269 66.90% 29.40% 0.37% 3.35% NA
Indica I  595 20.00% 0.20% 9.08% 70.76% NA
Indica II  465 12.70% 0.20% 9.68% 77.42% NA
Indica III  913 10.20% 0.70% 5.81% 83.35% NA
Indica Intermediate  786 13.70% 1.00% 8.02% 77.23% NA
Temperate Japonica  767 69.00% 0.00% 1.30% 29.73% NA
Tropical Japonica  504 14.90% 0.20% 2.58% 82.34% NA
Japonica Intermediate  241 29.00% 0.40% 4.56% 65.98% NA
VI/Aromatic  96 33.30% 29.20% 23.96% 13.54% NA
Intermediate  90 42.20% 8.90% 5.56% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208133155 G -> DEL N N silent_mutation Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1208133155 G -> A LOC_Os12g14280.1 upstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1208133155 G -> A LOC_Os12g14290.1 downstream_gene_variant ; 4360.0bp to feature; MODIFIER silent_mutation Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1208133155 G -> A LOC_Os12g14270-LOC_Os12g14280 intergenic_region ; MODIFIER silent_mutation Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208133155 3.71E-07 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208133155 1.63E-10 NA mr1090_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208133155 7.17E-07 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208133155 NA 2.01E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251