Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208133155:

Variant ID: vg1208133155 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8133155
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATAGGGCTCGGGGTCTATTTATACCCAAGAATTACAAGATATGTCCATATCGGACACGACTATTATCTCTAACAAACTCTAAGATACCATAAGTCTTT[G/A]
CGGCAGACTTTTGCCCACATTTATCTCTAAAGAATTTACATAAAATATCCTAATTAATAGATACAATTGCCTTCTTAGGACTCTATCCATGCGCGGCAAT

Reverse complement sequence

ATTGCCGCGCATGGATAGAGTCCTAAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTAAATTCTTTAGAGATAAATGTGGGCAAAAGTCTGCCG[C/T]
AAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTCGTGTCCGATATGGACATATCTTGTAATTCTTGGGTATAAATAGACCCCGAGCCCTATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.60%	2.80%	5.88%	63.73%	NA
All Indica	2759	13.70%	0.60%	7.79%	77.89%	NA
All Japonica	1512	44.60%	0.10%	2.25%	53.04%	NA
Aus	269	66.90%	29.40%	0.37%	3.35%	NA
Indica I	595	20.00%	0.20%	9.08%	70.76%	NA
Indica II	465	12.70%	0.20%	9.68%	77.42%	NA
Indica III	913	10.20%	0.70%	5.81%	83.35%	NA
Indica Intermediate	786	13.70%	1.00%	8.02%	77.23%	NA
Temperate Japonica	767	69.00%	0.00%	1.30%	29.73%	NA
Tropical Japonica	504	14.90%	0.20%	2.58%	82.34%	NA
Japonica Intermediate	241	29.00%	0.40%	4.56%	65.98%	NA
VI/Aromatic	96	33.30%	29.20%	23.96%	13.54%	NA
Intermediate	90	42.20%	8.90%	5.56%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208133155	G -> DEL	N	N	silent_mutation	Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg1208133155	G -> A	LOC_Os12g14280.1	upstream_gene_variant ; 585.0bp to feature; MODIFIER	silent_mutation	Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg1208133155	G -> A	LOC_Os12g14290.1	downstream_gene_variant ; 4360.0bp to feature; MODIFIER	silent_mutation	Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg1208133155	G -> A	LOC_Os12g14270-LOC_Os12g14280	intergenic_region ; MODIFIER	silent_mutation	Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208133155	3.71E-07	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208133155	1.63E-10	NA	mr1090_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208133155	7.17E-07	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208133155	NA	2.01E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251