| Variant ID: vg1208133155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8133155 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATAGGGCTCGGGGTCTATTTATACCCAAGAATTACAAGATATGTCCATATCGGACACGACTATTATCTCTAACAAACTCTAAGATACCATAAGTCTTT[G/A]
CGGCAGACTTTTGCCCACATTTATCTCTAAAGAATTTACATAAAATATCCTAATTAATAGATACAATTGCCTTCTTAGGACTCTATCCATGCGCGGCAAT
ATTGCCGCGCATGGATAGAGTCCTAAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTAAATTCTTTAGAGATAAATGTGGGCAAAAGTCTGCCG[C/T]
AAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTCGTGTCCGATATGGACATATCTTGTAATTCTTGGGTATAAATAGACCCCGAGCCCTATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.60% | 2.80% | 5.88% | 63.73% | NA |
| All Indica | 2759 | 13.70% | 0.60% | 7.79% | 77.89% | NA |
| All Japonica | 1512 | 44.60% | 0.10% | 2.25% | 53.04% | NA |
| Aus | 269 | 66.90% | 29.40% | 0.37% | 3.35% | NA |
| Indica I | 595 | 20.00% | 0.20% | 9.08% | 70.76% | NA |
| Indica II | 465 | 12.70% | 0.20% | 9.68% | 77.42% | NA |
| Indica III | 913 | 10.20% | 0.70% | 5.81% | 83.35% | NA |
| Indica Intermediate | 786 | 13.70% | 1.00% | 8.02% | 77.23% | NA |
| Temperate Japonica | 767 | 69.00% | 0.00% | 1.30% | 29.73% | NA |
| Tropical Japonica | 504 | 14.90% | 0.20% | 2.58% | 82.34% | NA |
| Japonica Intermediate | 241 | 29.00% | 0.40% | 4.56% | 65.98% | NA |
| VI/Aromatic | 96 | 33.30% | 29.20% | 23.96% | 13.54% | NA |
| Intermediate | 90 | 42.20% | 8.90% | 5.56% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208133155 | G -> DEL | N | N | silent_mutation | Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1208133155 | G -> A | LOC_Os12g14280.1 | upstream_gene_variant ; 585.0bp to feature; MODIFIER | silent_mutation | Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1208133155 | G -> A | LOC_Os12g14290.1 | downstream_gene_variant ; 4360.0bp to feature; MODIFIER | silent_mutation | Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1208133155 | G -> A | LOC_Os12g14270-LOC_Os12g14280 | intergenic_region ; MODIFIER | silent_mutation | Average:21.362; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208133155 | 3.71E-07 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208133155 | 1.63E-10 | NA | mr1090_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208133155 | 7.17E-07 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208133155 | NA | 2.01E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |