\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208119667:

Variant ID: vg1208119667 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8119667
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGAGCTACGTATTGTGGATACATTTTTCTGCGTCCCATAATGTGGCGGAATACGAGGCGCTACTCCATGGACTAAGGATTGCAATATCTCTAAGTATT[C/T]
GCCGACTAATCGTCCGTGGATACTCTCAGTTGGTTGTCAATCAAGTCATGAAAGAGTGGTCATGTCTAGATGATAATATGACCGCTTATCGACAAGAGGT

Reverse complement sequence

ACCTCTTGTCGATAAGCGGTCATATTATCATCTAGACATGACCACTCTTTCATGACTTGATTGACAACCAACTGAGAGTATCCACGGACGATTAGTCGGC[G/A]
AATACTTAGAGATATTGCAATCCTTAGTCCATGGAGTAGCGCCTCGTATTCCGCCACATTATGGGACGCAGAAAAATGTATCCACAATACGTAGCTCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.10% 4.90% 7.96% 13.08% NA
All Indica  2759 93.80% 0.60% 5.55% 0.11% NA
All Japonica  1512 32.80% 13.40% 13.76% 40.08% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 85.90% 0.50% 13.28% 0.34% NA
Indica II  465 94.60% 1.70% 3.66% 0.00% NA
Indica III  913 96.90% 0.10% 2.96% 0.00% NA
Indica Intermediate  786 95.50% 0.50% 3.82% 0.13% NA
Temperate Japonica  767 41.60% 24.90% 12.78% 20.73% NA
Tropical Japonica  504 21.20% 0.20% 18.06% 60.52% NA
Japonica Intermediate  241 29.00% 4.10% 7.88% 58.92% NA
VI/Aromatic  96 92.70% 1.00% 1.04% 5.21% NA
Intermediate  90 66.70% 14.40% 14.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208119667 C -> DEL LOC_Os12g14260.1 N frameshift_variant Average:21.727; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg1208119667 C -> T LOC_Os12g14260.1 missense_variant ; p.Arg1324Cys; MODERATE nonsynonymous_codon ; R1324C Average:21.727; most accessible tissue: Minghui63 root, score: 35.002 unknown unknown DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208119667 NA 7.46E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 2.76E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 3.55E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 4.54E-06 8.80E-15 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 1.54E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 1.69E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 2.48E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 4.00E-06 1.54E-15 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 3.29E-09 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 1.89E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208119667 NA 4.14E-07 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251