\
| Variant ID: vg1208119667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8119667 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )
ATTGAGCTACGTATTGTGGATACATTTTTCTGCGTCCCATAATGTGGCGGAATACGAGGCGCTACTCCATGGACTAAGGATTGCAATATCTCTAAGTATT[C/T]
GCCGACTAATCGTCCGTGGATACTCTCAGTTGGTTGTCAATCAAGTCATGAAAGAGTGGTCATGTCTAGATGATAATATGACCGCTTATCGACAAGAGGT
ACCTCTTGTCGATAAGCGGTCATATTATCATCTAGACATGACCACTCTTTCATGACTTGATTGACAACCAACTGAGAGTATCCACGGACGATTAGTCGGC[G/A]
AATACTTAGAGATATTGCAATCCTTAGTCCATGGAGTAGCGCCTCGTATTCCGCCACATTATGGGACGCAGAAAAATGTATCCACAATACGTAGCTCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.10% | 4.90% | 7.96% | 13.08% | NA |
| All Indica | 2759 | 93.80% | 0.60% | 5.55% | 0.11% | NA |
| All Japonica | 1512 | 32.80% | 13.40% | 13.76% | 40.08% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 85.90% | 0.50% | 13.28% | 0.34% | NA |
| Indica II | 465 | 94.60% | 1.70% | 3.66% | 0.00% | NA |
| Indica III | 913 | 96.90% | 0.10% | 2.96% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 0.50% | 3.82% | 0.13% | NA |
| Temperate Japonica | 767 | 41.60% | 24.90% | 12.78% | 20.73% | NA |
| Tropical Japonica | 504 | 21.20% | 0.20% | 18.06% | 60.52% | NA |
| Japonica Intermediate | 241 | 29.00% | 4.10% | 7.88% | 58.92% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 66.70% | 14.40% | 14.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208119667 | C -> DEL | LOC_Os12g14260.1 | N | frameshift_variant | Average:21.727; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg1208119667 | C -> T | LOC_Os12g14260.1 | missense_variant ; p.Arg1324Cys; MODERATE | nonsynonymous_codon ; R1324C | Average:21.727; most accessible tissue: Minghui63 root, score: 35.002 | unknown | unknown | DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208119667 | NA | 7.46E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 2.76E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 3.55E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | 4.54E-06 | 8.80E-15 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 1.54E-10 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 1.69E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 2.48E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | 4.00E-06 | 1.54E-15 | mr1182_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 3.29E-09 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 1.89E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208119667 | NA | 4.14E-07 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |