\
| Variant ID: vg1208079291 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8079291 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAGGATAATTTATGATAAACAATTATGGATAGTTTACTGACCTTGGTTTTTGTACACTAGCTTTTTGGTTCCTTACAACAGTGAGATATTTTACAAGCT[G/A]
CATTTTTCATGTGTTTGCATCCTCTGAATTGGATTTTAATTCATAGTAAAATATTAAGGCAAGTTGTTTAATGTTCATCTCAATTATAAACATTTGTGTT
AACACAAATGTTTATAATTGAGATGAACATTAAACAACTTGCCTTAATATTTTACTATGAATTAAAATCCAATTCAGAGGATGCAAACACATGAAAAATG[C/T]
AGCTTGTAAAATATCTCACTGTTGTAAGGAACCAAAAAGCTAGTGTACAAAAACCAAGGTCAGTAAACTATCCATAATTGTTTATCATAAATTATCCTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.40% | 19.90% | 10.16% | 19.47% | NA |
| All Indica | 2759 | 54.20% | 28.10% | 11.34% | 6.31% | NA |
| All Japonica | 1512 | 46.00% | 7.50% | 5.62% | 40.94% | NA |
| Aus | 269 | 33.80% | 10.00% | 17.10% | 39.03% | NA |
| Indica I | 595 | 36.00% | 29.60% | 21.51% | 12.94% | NA |
| Indica II | 465 | 45.60% | 33.50% | 13.76% | 7.10% | NA |
| Indica III | 913 | 69.30% | 23.80% | 4.93% | 1.97% | NA |
| Indica Intermediate | 786 | 55.60% | 28.90% | 9.67% | 5.85% | NA |
| Temperate Japonica | 767 | 69.50% | 1.20% | 3.52% | 25.81% | NA |
| Tropical Japonica | 504 | 18.30% | 18.70% | 6.94% | 56.15% | NA |
| Japonica Intermediate | 241 | 29.00% | 4.10% | 9.54% | 57.26% | NA |
| VI/Aromatic | 96 | 46.90% | 10.40% | 33.33% | 9.38% | NA |
| Intermediate | 90 | 63.30% | 17.80% | 4.44% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208079291 | G -> DEL | N | N | silent_mutation | Average:23.298; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1208079291 | G -> A | LOC_Os12g14220.1 | downstream_gene_variant ; 2476.0bp to feature; MODIFIER | silent_mutation | Average:23.298; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1208079291 | G -> A | LOC_Os12g14230.1 | downstream_gene_variant ; 4172.0bp to feature; MODIFIER | silent_mutation | Average:23.298; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1208079291 | G -> A | LOC_Os12g14224.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.298; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208079291 | 4.78E-06 | 5.67E-09 | mr1422 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208079291 | NA | 5.09E-08 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208079291 | NA | 1.15E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208079291 | NA | 9.53E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208079291 | NA | 5.70E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208079291 | NA | 4.35E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208079291 | NA | 8.64E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |