Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1208078669:

Variant ID: vg1208078669 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8078669
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCAGCCAGTCACCGAGTTATAGAGTTGGTGACGGTGCAGTAATATAAAGCCCTCACCATACTGTGTGATGGACTTAAATGGGCCAAGCTGCTCTGCCT[C/T]
TGTCTGAAATTGTGAACCACTAAAAACAGAGTGCTCTTCTCGTTCCCCATGGCTCTTGCCCTAGTGAGCTCCACGCCTCCACCTCGACGCCGCAACTCTG

Reverse complement sequence

CAGAGTTGCGGCGTCGAGGTGGAGGCGTGGAGCTCACTAGGGCAAGAGCCATGGGGAACGAGAAGAGCACTCTGTTTTTAGTGGTTCACAATTTCAGACA[G/A]
AGGCAGAGCAGCTTGGCCCATTTAAGTCCATCACACAGTATGGTGAGGGCTTTATATTACTGCACCGTCACCAACTCTATAACTCGGTGACTGGCTGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 1.20% 3.00% 19.42% NA
All Indica  2759 90.40% 0.00% 2.57% 7.00% NA
All Japonica  1512 45.60% 3.60% 4.56% 46.23% NA
Aus  269 98.90% 0.00% 0.00% 1.12% NA
Indica I  595 85.40% 0.00% 2.18% 12.44% NA
Indica II  465 94.40% 0.00% 0.86% 4.73% NA
Indica III  913 91.60% 0.00% 3.83% 4.60% NA
Indica Intermediate  786 90.60% 0.00% 2.42% 7.00% NA
Temperate Japonica  767 68.70% 4.40% 5.61% 21.25% NA
Tropical Japonica  504 20.20% 0.00% 3.97% 75.79% NA
Japonica Intermediate  241 24.90% 8.70% 2.49% 63.90% NA
VI/Aromatic  96 92.70% 1.00% 0.00% 6.25% NA
Intermediate  90 78.90% 0.00% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208078669 C -> DEL N N silent_mutation Average:84.633; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg1208078669 C -> T LOC_Os12g14224.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:84.633; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg1208078669 C -> T LOC_Os12g14224.1 5_prime_UTR_variant ; 125.0bp to feature; MODIFIER silent_mutation Average:84.633; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg1208078669 C -> T LOC_Os12g14210.1 downstream_gene_variant ; 4659.0bp to feature; MODIFIER silent_mutation Average:84.633; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg1208078669 C -> T LOC_Os12g14220.1 downstream_gene_variant ; 1854.0bp to feature; MODIFIER silent_mutation Average:84.633; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg1208078669 C -> T LOC_Os12g14230.1 downstream_gene_variant ; 4794.0bp to feature; MODIFIER silent_mutation Average:84.633; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1208078669 C T 0.08 0.05 0.05 0.05 0.06 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208078669 NA 7.97E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208078669 7.04E-06 3.93E-08 mr1006 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208078669 4.36E-06 4.58E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208078669 NA 2.85E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208078669 5.61E-06 5.61E-06 mr1037 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208078669 NA 8.25E-08 mr1052 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208078669 NA 4.54E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208078669 NA 7.20E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208078669 NA 7.65E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251