\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208075076:

Variant ID: vg1208075076 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8075076
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AGAACACCAGGGGTCACATATTAGTATCCAACAAACCAACAGTGATAGAGATATAAAGTAGTGTGAGCCGACTGCCGGCGGCGCAAGGCAGCAAAACCGC[C/T]
AATTAGCGGTCAGTCATGCGCCCTCCCGCCTACACGGCACAGCCATGCGGCACGCGCGGAGAGGGGGGAGGGGGGGTTGCGTTGAAGGCAACACGTGTCA

Reverse complement sequence

TGACACGTGTTGCCTTCAACGCAACCCCCCCTCCCCCCTCTCCGCGCGTGCCGCATGGCTGTGCCGTGTAGGCGGGAGGGCGCATGACTGACCGCTAATT[G/A]
GCGGTTTTGCTGCCTTGCGCCGCCGGCAGTCGGCTCACACTACTTTATATCTCTATCACTGTTGGTTTGTTGGATACTAATATGTGACCCCTGGTGTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.30% 41.80% 9.80% 3.15% NA
All Indica  2759 46.60% 50.80% 2.46% 0.11% NA
All Japonica  1512 44.10% 21.40% 25.07% 9.39% NA
Aus  269 33.10% 66.50% 0.37% 0.00% NA
Indica I  595 31.10% 66.70% 2.02% 0.17% NA
Indica II  465 41.10% 57.60% 1.29% 0.00% NA
Indica III  913 59.50% 38.20% 2.08% 0.22% NA
Indica Intermediate  786 46.80% 49.20% 3.94% 0.00% NA
Temperate Japonica  767 68.40% 13.80% 13.04% 4.69% NA
Tropical Japonica  504 15.10% 30.00% 40.28% 14.68% NA
Japonica Intermediate  241 27.40% 27.80% 31.54% 13.28% NA
VI/Aromatic  96 47.90% 45.80% 5.21% 1.04% NA
Intermediate  90 56.70% 28.90% 11.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208075076 C -> DEL N N silent_mutation Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg1208075076 C -> T LOC_Os12g14220.1 upstream_gene_variant ; 1208.0bp to feature; MODIFIER silent_mutation Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg1208075076 C -> T LOC_Os12g14224.1 upstream_gene_variant ; 3540.0bp to feature; MODIFIER silent_mutation Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg1208075076 C -> T LOC_Os12g14210.1 downstream_gene_variant ; 1066.0bp to feature; MODIFIER silent_mutation Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg1208075076 C -> T LOC_Os12g14210-LOC_Os12g14220 intergenic_region ; MODIFIER silent_mutation Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208075076 NA 7.17E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208075076 6.99E-06 3.77E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 1.49E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 6.27E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 4.76E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 3.81E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 1.75E-08 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 7.18E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 1.28E-07 NA mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 2.90E-09 5.50E-20 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 7.97E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 2.29E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 2.28E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 1.32E-10 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 5.49E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076 NA 9.19E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251