Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208075076:

Variant ID: vg1208075076 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8075076
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

AGAACACCAGGGGTCACATATTAGTATCCAACAAACCAACAGTGATAGAGATATAAAGTAGTGTGAGCCGACTGCCGGCGGCGCAAGGCAGCAAAACCGC[C/T]
AATTAGCGGTCAGTCATGCGCCCTCCCGCCTACACGGCACAGCCATGCGGCACGCGCGGAGAGGGGGGAGGGGGGGTTGCGTTGAAGGCAACACGTGTCA

Reverse complement sequence

TGACACGTGTTGCCTTCAACGCAACCCCCCCTCCCCCCTCTCCGCGCGTGCCGCATGGCTGTGCCGTGTAGGCGGGAGGGCGCATGACTGACCGCTAATT[G/A]
GCGGTTTTGCTGCCTTGCGCCGCCGGCAGTCGGCTCACACTACTTTATATCTCTATCACTGTTGGTTTGTTGGATACTAATATGTGACCCCTGGTGTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	41.80%	9.80%	3.15%	NA
All Indica	2759	46.60%	50.80%	2.46%	0.11%	NA
All Japonica	1512	44.10%	21.40%	25.07%	9.39%	NA
Aus	269	33.10%	66.50%	0.37%	0.00%	NA
Indica I	595	31.10%	66.70%	2.02%	0.17%	NA
Indica II	465	41.10%	57.60%	1.29%	0.00%	NA
Indica III	913	59.50%	38.20%	2.08%	0.22%	NA
Indica Intermediate	786	46.80%	49.20%	3.94%	0.00%	NA
Temperate Japonica	767	68.40%	13.80%	13.04%	4.69%	NA
Tropical Japonica	504	15.10%	30.00%	40.28%	14.68%	NA
Japonica Intermediate	241	27.40%	27.80%	31.54%	13.28%	NA
VI/Aromatic	96	47.90%	45.80%	5.21%	1.04%	NA
Intermediate	90	56.70%	28.90%	11.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208075076	C -> DEL	N	N	silent_mutation	Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432	N	N	N	N
vg1208075076	C -> T	LOC_Os12g14220.1	upstream_gene_variant ; 1208.0bp to feature; MODIFIER	silent_mutation	Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432	N	N	N	N
vg1208075076	C -> T	LOC_Os12g14224.1	upstream_gene_variant ; 3540.0bp to feature; MODIFIER	silent_mutation	Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432	N	N	N	N
vg1208075076	C -> T	LOC_Os12g14210.1	downstream_gene_variant ; 1066.0bp to feature; MODIFIER	silent_mutation	Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432	N	N	N	N
vg1208075076	C -> T	LOC_Os12g14210-LOC_Os12g14220	intergenic_region ; MODIFIER	silent_mutation	Average:60.659; most accessible tissue: Zhenshan97 panicle, score: 86.432	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208075076	NA	7.17E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208075076	6.99E-06	3.77E-13	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	1.49E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	6.27E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	4.76E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	3.81E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	1.75E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	7.18E-07	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	1.28E-07	NA	mr1002_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	2.90E-09	5.50E-20	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	7.97E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	2.29E-09	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	2.28E-09	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	1.32E-10	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	5.49E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208075076	NA	9.19E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251