\
| Variant ID: vg1208067607 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8067607 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )
TACGTCTCCTTTAATTAATTAGGTCCTTGTATATAAGTAGACTATAGAAAATAATATACTCCCTTTTATCGTTGTAGAATGGAGATTCAAAGGGCCCGAC[G/A]
GTGGAGGGTTTTTGATACTGGATTCATCGACACTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAAAGGACAATCTCGTCCATCTC
GAGATGGACGAGATTGTCCTTTGTTTCTTGTGGATATTGGTCGAGCATTGCGACGTTTACTCTCCGAGTGTCGATGAATCCAGTATCAAAAACCCTCCAC[C/T]
GTCGGGCCCTTTGAATCTCCATTCTACAACGATAAAAGGGAGTATATTATTTTCTATAGTCTACTTATATACAAGGACCTAATTAATTAAAGGAGACGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 16.90% | 4.30% | 8.13% | 70.74% | NA |
| All Indica | 2759 | 3.40% | 6.90% | 8.63% | 81.08% | NA |
| All Japonica | 1512 | 42.90% | 0.60% | 1.32% | 55.16% | NA |
| Aus | 269 | 3.30% | 0.00% | 24.91% | 71.75% | NA |
| Indica I | 595 | 4.50% | 8.90% | 10.59% | 75.97% | NA |
| Indica II | 465 | 4.30% | 6.90% | 12.47% | 76.34% | NA |
| Indica III | 913 | 2.00% | 5.30% | 5.81% | 86.97% | NA |
| Indica Intermediate | 786 | 3.80% | 7.10% | 8.14% | 80.92% | NA |
| Temperate Japonica | 767 | 68.10% | 1.00% | 1.17% | 29.73% | NA |
| Tropical Japonica | 504 | 12.10% | 0.20% | 1.39% | 86.31% | NA |
| Japonica Intermediate | 241 | 27.40% | 0.00% | 1.66% | 70.95% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 50.00% | 29.17% | NA |
| Intermediate | 90 | 27.80% | 3.30% | 12.22% | 56.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208067607 | G -> DEL | LOC_Os12g14200.1 | N | frameshift_variant | Average:6.569; most accessible tissue: Minghui63 root, score: 10.708 | N | N | N | N |
| vg1208067607 | G -> A | LOC_Os12g14200.1 | missense_variant ; p.Arg775Gln; MODERATE | nonsynonymous_codon ; R775Q | Average:6.569; most accessible tissue: Minghui63 root, score: 10.708 | benign |
0.37 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208067607 | NA | 7.48E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 1.34E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 2.41E-06 | mr1474_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 1.19E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 2.98E-07 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 5.87E-08 | mr1576_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 5.46E-07 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 1.21E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208067607 | NA | 1.12E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |