\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208067607:

Variant ID: vg1208067607 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8067607
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TACGTCTCCTTTAATTAATTAGGTCCTTGTATATAAGTAGACTATAGAAAATAATATACTCCCTTTTATCGTTGTAGAATGGAGATTCAAAGGGCCCGAC[G/A]
GTGGAGGGTTTTTGATACTGGATTCATCGACACTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAAAGGACAATCTCGTCCATCTC

Reverse complement sequence

GAGATGGACGAGATTGTCCTTTGTTTCTTGTGGATATTGGTCGAGCATTGCGACGTTTACTCTCCGAGTGTCGATGAATCCAGTATCAAAAACCCTCCAC[C/T]
GTCGGGCCCTTTGAATCTCCATTCTACAACGATAAAAGGGAGTATATTATTTTCTATAGTCTACTTATATACAAGGACCTAATTAATTAAAGGAGACGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 16.90% 4.30% 8.13% 70.74% NA
All Indica  2759 3.40% 6.90% 8.63% 81.08% NA
All Japonica  1512 42.90% 0.60% 1.32% 55.16% NA
Aus  269 3.30% 0.00% 24.91% 71.75% NA
Indica I  595 4.50% 8.90% 10.59% 75.97% NA
Indica II  465 4.30% 6.90% 12.47% 76.34% NA
Indica III  913 2.00% 5.30% 5.81% 86.97% NA
Indica Intermediate  786 3.80% 7.10% 8.14% 80.92% NA
Temperate Japonica  767 68.10% 1.00% 1.17% 29.73% NA
Tropical Japonica  504 12.10% 0.20% 1.39% 86.31% NA
Japonica Intermediate  241 27.40% 0.00% 1.66% 70.95% NA
VI/Aromatic  96 20.80% 0.00% 50.00% 29.17% NA
Intermediate  90 27.80% 3.30% 12.22% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208067607 G -> DEL LOC_Os12g14200.1 N frameshift_variant Average:6.569; most accessible tissue: Minghui63 root, score: 10.708 N N N N
vg1208067607 G -> A LOC_Os12g14200.1 missense_variant ; p.Arg775Gln; MODERATE nonsynonymous_codon ; R775Q Average:6.569; most accessible tissue: Minghui63 root, score: 10.708 benign 0.37 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208067607 NA 7.48E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 1.34E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 2.41E-06 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 1.19E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 2.98E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 5.87E-08 mr1576_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 5.46E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 1.21E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208067607 NA 1.12E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251