Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208031898:

Variant ID: vg1208031898 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8031898
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

GCTAGCTCCACGCCCTATACTAGAAGATTCTCCTACTACTTAGAGCGGAGTATCTGTTTTTGCGTTGCCTACAAATCGATCGATTTGCCTTGATTTTGGG[T/C]
TAATTTTCGTTACTTTTTCTTGATTGAGGATTTACATCTACTACTTTTGAAAGGATTTTTATCACTAAACGGCTAAGATTAGATATATTTTGCTCGCCAG

Reverse complement sequence

CTGGCGAGCAAAATATATCTAATCTTAGCCGTTTAGTGATAAAAATCCTTTCAAAAGTAGTAGATGTAAATCCTCAATCAAGAAAAAGTAACGAAAATTA[A/G]
CCCAAAATCAAGGCAAATCGATCGATTTGTAGGCAACGCAAAAACAGATACTCCGCTCTAAGTAGTAGGAGAATCTTCTAGTATAGGGCGTGGAGCTAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.20%	36.40%	0.17%	18.22%	NA
All Indica	2759	64.00%	35.00%	0.07%	0.87%	NA
All Japonica	1512	2.20%	46.00%	0.40%	51.39%	NA
Aus	269	97.00%	2.20%	0.00%	0.74%	NA
Indica I	595	51.10%	48.10%	0.17%	0.67%	NA
Indica II	465	47.70%	51.40%	0.00%	0.86%	NA
Indica III	913	79.70%	19.60%	0.00%	0.66%	NA
Indica Intermediate	786	65.30%	33.30%	0.13%	1.27%	NA
Temperate Japonica	767	0.80%	72.60%	0.13%	26.47%	NA
Tropical Japonica	504	4.40%	13.50%	0.60%	81.55%	NA
Japonica Intermediate	241	2.50%	29.00%	0.83%	67.63%	NA
VI/Aromatic	96	36.50%	20.80%	0.00%	42.71%	NA
Intermediate	90	43.30%	37.80%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208031898	T -> C	LOC_Os12g14140.1	downstream_gene_variant ; 4485.0bp to feature; MODIFIER	silent_mutation	Average:63.769; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N
vg1208031898	T -> C	LOC_Os12g14150.1	intron_variant ; MODIFIER	silent_mutation	Average:63.769; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N
vg1208031898	T -> DEL	N	N	silent_mutation	Average:63.769; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208031898	NA	1.92E-06	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	1.27E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	1.32E-09	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	5.67E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	7.77E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	9.15E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	6.23E-07	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	4.45E-07	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	2.80E-11	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	2.50E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	3.33E-08	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	7.30E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	7.78E-07	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	4.45E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	2.47E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	4.89E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	1.72E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	9.30E-09	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	7.51E-13	mr1576_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	8.04E-07	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	3.84E-09	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	1.00E-07	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	1.54E-08	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	5.58E-08	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	2.45E-10	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	6.36E-08	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	4.47E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	1.23E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898	NA	2.30E-06	mr1994_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251