\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208031898:

Variant ID: vg1208031898 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8031898
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


GCTAGCTCCACGCCCTATACTAGAAGATTCTCCTACTACTTAGAGCGGAGTATCTGTTTTTGCGTTGCCTACAAATCGATCGATTTGCCTTGATTTTGGG[T/C]
TAATTTTCGTTACTTTTTCTTGATTGAGGATTTACATCTACTACTTTTGAAAGGATTTTTATCACTAAACGGCTAAGATTAGATATATTTTGCTCGCCAG

Reverse complement sequence

CTGGCGAGCAAAATATATCTAATCTTAGCCGTTTAGTGATAAAAATCCTTTCAAAAGTAGTAGATGTAAATCCTCAATCAAGAAAAAGTAACGAAAATTA[A/G]
CCCAAAATCAAGGCAAATCGATCGATTTGTAGGCAACGCAAAAACAGATACTCCGCTCTAAGTAGTAGGAGAATCTTCTAGTATAGGGCGTGGAGCTAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 36.40% 0.17% 18.22% NA
All Indica  2759 64.00% 35.00% 0.07% 0.87% NA
All Japonica  1512 2.20% 46.00% 0.40% 51.39% NA
Aus  269 97.00% 2.20% 0.00% 0.74% NA
Indica I  595 51.10% 48.10% 0.17% 0.67% NA
Indica II  465 47.70% 51.40% 0.00% 0.86% NA
Indica III  913 79.70% 19.60% 0.00% 0.66% NA
Indica Intermediate  786 65.30% 33.30% 0.13% 1.27% NA
Temperate Japonica  767 0.80% 72.60% 0.13% 26.47% NA
Tropical Japonica  504 4.40% 13.50% 0.60% 81.55% NA
Japonica Intermediate  241 2.50% 29.00% 0.83% 67.63% NA
VI/Aromatic  96 36.50% 20.80% 0.00% 42.71% NA
Intermediate  90 43.30% 37.80% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208031898 T -> C LOC_Os12g14140.1 downstream_gene_variant ; 4485.0bp to feature; MODIFIER silent_mutation Average:63.769; most accessible tissue: Minghui63 root, score: 79.74 N N N N
vg1208031898 T -> C LOC_Os12g14150.1 intron_variant ; MODIFIER silent_mutation Average:63.769; most accessible tissue: Minghui63 root, score: 79.74 N N N N
vg1208031898 T -> DEL N N silent_mutation Average:63.769; most accessible tissue: Minghui63 root, score: 79.74 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208031898 NA 1.92E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 1.27E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 1.32E-09 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 5.67E-08 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 7.77E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 9.15E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 6.23E-07 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 4.45E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 2.80E-11 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 2.50E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 3.33E-08 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 7.30E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 7.78E-07 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 4.45E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 2.47E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 4.89E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 1.72E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 9.30E-09 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 7.51E-13 mr1576_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 8.04E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 3.84E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 1.00E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 1.54E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 5.58E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 2.45E-10 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 6.36E-08 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 4.47E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 1.23E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208031898 NA 2.30E-06 mr1994_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251