Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208021026:

Variant ID: vg1208021026 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8021026
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

AAATGACCGTCTAAAAAAAATATAAATCGGCATGACGTTCGCTGTCCGCCTGCGAAAATCTATTTTCGCACGCGCCTCTATTTTCACAGGCACACCTTAT[G/A]
TGGTCTGCCTGCAGAAATAGTACCTACCAAAAAAATCTAGTCATCCTCATCCGTATCCTCTCCTCCACCATCCTTATCCTCTCCTCTCCACCACTCGTTT

Reverse complement sequence

AAACGAGTGGTGGAGAGGAGAGGATAAGGATGGTGGAGGAGAGGATACGGATGAGGATGACTAGATTTTTTTGGTAGGTACTATTTCTGCAGGCAGACCA[C/T]
ATAAGGTGTGCCTGTGAAAATAGAGGCGCGTGCGAAAATAGATTTTCGCAGGCGGACAGCGAACGTCATGCCGATTTATATTTTTTTTAGACGGTCATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.40%	34.00%	0.25%	17.31%	NA
All Indica	2759	77.30%	22.00%	0.07%	0.62%	NA
All Japonica	1512	5.60%	42.30%	0.66%	51.39%	NA
Aus	269	1.90%	97.40%	0.00%	0.74%	NA
Indica I	595	72.90%	26.40%	0.00%	0.67%	NA
Indica II	465	85.80%	13.80%	0.00%	0.43%	NA
Indica III	913	78.90%	20.70%	0.11%	0.33%	NA
Indica Intermediate	786	73.70%	25.20%	0.13%	1.02%	NA
Temperate Japonica	767	6.60%	66.80%	0.39%	26.21%	NA
Tropical Japonica	504	5.20%	11.90%	0.79%	82.14%	NA
Japonica Intermediate	241	3.30%	28.20%	1.24%	67.22%	NA
VI/Aromatic	96	38.50%	55.20%	0.00%	6.25%	NA
Intermediate	90	31.10%	51.10%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208021026	G -> DEL	N	N	silent_mutation	Average:58.034; most accessible tissue: Callus, score: 69.2	N	N	N	N
vg1208021026	G -> A	LOC_Os12g14140.1	upstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:58.034; most accessible tissue: Callus, score: 69.2	N	N	N	N
vg1208021026	G -> A	LOC_Os12g14126.1	downstream_gene_variant ; 1082.0bp to feature; MODIFIER	silent_mutation	Average:58.034; most accessible tissue: Callus, score: 69.2	N	N	N	N
vg1208021026	G -> A	LOC_Os12g14132.1	downstream_gene_variant ; 2494.0bp to feature; MODIFIER	silent_mutation	Average:58.034; most accessible tissue: Callus, score: 69.2	N	N	N	N
vg1208021026	G -> A	LOC_Os12g14126-LOC_Os12g14132	intergenic_region ; MODIFIER	silent_mutation	Average:58.034; most accessible tissue: Callus, score: 69.2	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208021026	NA	1.40E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	2.14E-06	NA	mr1350	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	1.23E-06	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	1.00E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	6.14E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	9.68E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	2.91E-25	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	3.33E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	2.66E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026	NA	5.86E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251