\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208021026:

Variant ID: vg1208021026 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8021026
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGACCGTCTAAAAAAAATATAAATCGGCATGACGTTCGCTGTCCGCCTGCGAAAATCTATTTTCGCACGCGCCTCTATTTTCACAGGCACACCTTAT[G/A]
TGGTCTGCCTGCAGAAATAGTACCTACCAAAAAAATCTAGTCATCCTCATCCGTATCCTCTCCTCCACCATCCTTATCCTCTCCTCTCCACCACTCGTTT

Reverse complement sequence

AAACGAGTGGTGGAGAGGAGAGGATAAGGATGGTGGAGGAGAGGATACGGATGAGGATGACTAGATTTTTTTGGTAGGTACTATTTCTGCAGGCAGACCA[C/T]
ATAAGGTGTGCCTGTGAAAATAGAGGCGCGTGCGAAAATAGATTTTCGCAGGCGGACAGCGAACGTCATGCCGATTTATATTTTTTTTAGACGGTCATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 34.00% 0.25% 17.31% NA
All Indica  2759 77.30% 22.00% 0.07% 0.62% NA
All Japonica  1512 5.60% 42.30% 0.66% 51.39% NA
Aus  269 1.90% 97.40% 0.00% 0.74% NA
Indica I  595 72.90% 26.40% 0.00% 0.67% NA
Indica II  465 85.80% 13.80% 0.00% 0.43% NA
Indica III  913 78.90% 20.70% 0.11% 0.33% NA
Indica Intermediate  786 73.70% 25.20% 0.13% 1.02% NA
Temperate Japonica  767 6.60% 66.80% 0.39% 26.21% NA
Tropical Japonica  504 5.20% 11.90% 0.79% 82.14% NA
Japonica Intermediate  241 3.30% 28.20% 1.24% 67.22% NA
VI/Aromatic  96 38.50% 55.20% 0.00% 6.25% NA
Intermediate  90 31.10% 51.10% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208021026 G -> DEL N N silent_mutation Average:58.034; most accessible tissue: Callus, score: 69.2 N N N N
vg1208021026 G -> A LOC_Os12g14140.1 upstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:58.034; most accessible tissue: Callus, score: 69.2 N N N N
vg1208021026 G -> A LOC_Os12g14126.1 downstream_gene_variant ; 1082.0bp to feature; MODIFIER silent_mutation Average:58.034; most accessible tissue: Callus, score: 69.2 N N N N
vg1208021026 G -> A LOC_Os12g14132.1 downstream_gene_variant ; 2494.0bp to feature; MODIFIER silent_mutation Average:58.034; most accessible tissue: Callus, score: 69.2 N N N N
vg1208021026 G -> A LOC_Os12g14126-LOC_Os12g14132 intergenic_region ; MODIFIER silent_mutation Average:58.034; most accessible tissue: Callus, score: 69.2 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208021026 NA 1.40E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 2.14E-06 NA mr1350 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 1.23E-06 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 1.00E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 6.14E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 9.68E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 2.91E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 3.33E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 2.66E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208021026 NA 5.86E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251