\
| Variant ID: vg1208009403 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8009403 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.18, others allele: 0.00, population size: 90. )
GATTCCAATATGACATCGGCATCGGCTCGAAGATAAATGATATGCCATCGGCAACTAGCCGATCGGCTATCGTATATGGATTTAACCGTGGTTTTCTTGT[C/T]
TTTCTTTCTTGTTGATTACAGGATCAAATCAACTAGCACGCTCACGAACCTAAAAGCAAGATTTTGGACCTGCACTGAAGTTAAGTAGATCTTCTAGGCC
GGCCTAGAAGATCTACTTAACTTCAGTGCAGGTCCAAAATCTTGCTTTTAGGTTCGTGAGCGTGCTAGTTGATTTGATCCTGTAATCAACAAGAAAGAAA[G/A]
ACAAGAAAACCACGGTTAAATCCATATACGATAGCCGATCGGCTAGTTGCCGATGGCATATCATTTATCTTCGAGCCGATGCCGATGTCATATTGGAATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 28.20% | 0.44% | 17.18% | NA |
| All Indica | 2759 | 80.40% | 18.80% | 0.14% | 0.69% | NA |
| All Japonica | 1512 | 5.80% | 42.30% | 0.99% | 50.93% | NA |
| Aus | 269 | 66.90% | 32.30% | 0.00% | 0.74% | NA |
| Indica I | 595 | 77.10% | 21.80% | 0.34% | 0.67% | NA |
| Indica II | 465 | 86.90% | 12.70% | 0.00% | 0.43% | NA |
| Indica III | 913 | 81.40% | 18.20% | 0.11% | 0.33% | NA |
| Indica Intermediate | 786 | 77.90% | 20.70% | 0.13% | 1.27% | NA |
| Temperate Japonica | 767 | 6.60% | 66.80% | 0.65% | 25.95% | NA |
| Tropical Japonica | 504 | 5.40% | 11.70% | 1.19% | 81.75% | NA |
| Japonica Intermediate | 241 | 3.70% | 28.60% | 1.66% | 65.98% | NA |
| VI/Aromatic | 96 | 42.70% | 52.10% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 36.70% | 43.30% | 2.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208009403 | C -> DEL | N | N | silent_mutation | Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg1208009403 | C -> T | LOC_Os12g14110.1 | upstream_gene_variant ; 4904.0bp to feature; MODIFIER | silent_mutation | Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg1208009403 | C -> T | LOC_Os12g14120.1 | downstream_gene_variant ; 2424.0bp to feature; MODIFIER | silent_mutation | Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg1208009403 | C -> T | LOC_Os12g14110-LOC_Os12g14120 | intergenic_region ; MODIFIER | silent_mutation | Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208009403 | NA | 8.84E-07 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | 1.33E-06 | 1.33E-06 | mr1144 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 1.88E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 3.08E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 9.45E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 3.47E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 4.92E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 1.88E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 2.27E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 2.91E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208009403 | NA | 3.70E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |