\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208009403:

Variant ID: vg1208009403 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8009403
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.18, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GATTCCAATATGACATCGGCATCGGCTCGAAGATAAATGATATGCCATCGGCAACTAGCCGATCGGCTATCGTATATGGATTTAACCGTGGTTTTCTTGT[C/T]
TTTCTTTCTTGTTGATTACAGGATCAAATCAACTAGCACGCTCACGAACCTAAAAGCAAGATTTTGGACCTGCACTGAAGTTAAGTAGATCTTCTAGGCC

Reverse complement sequence

GGCCTAGAAGATCTACTTAACTTCAGTGCAGGTCCAAAATCTTGCTTTTAGGTTCGTGAGCGTGCTAGTTGATTTGATCCTGTAATCAACAAGAAAGAAA[G/A]
ACAAGAAAACCACGGTTAAATCCATATACGATAGCCGATCGGCTAGTTGCCGATGGCATATCATTTATCTTCGAGCCGATGCCGATGTCATATTGGAATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 28.20% 0.44% 17.18% NA
All Indica  2759 80.40% 18.80% 0.14% 0.69% NA
All Japonica  1512 5.80% 42.30% 0.99% 50.93% NA
Aus  269 66.90% 32.30% 0.00% 0.74% NA
Indica I  595 77.10% 21.80% 0.34% 0.67% NA
Indica II  465 86.90% 12.70% 0.00% 0.43% NA
Indica III  913 81.40% 18.20% 0.11% 0.33% NA
Indica Intermediate  786 77.90% 20.70% 0.13% 1.27% NA
Temperate Japonica  767 6.60% 66.80% 0.65% 25.95% NA
Tropical Japonica  504 5.40% 11.70% 1.19% 81.75% NA
Japonica Intermediate  241 3.70% 28.60% 1.66% 65.98% NA
VI/Aromatic  96 42.70% 52.10% 0.00% 5.21% NA
Intermediate  90 36.70% 43.30% 2.22% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208009403 C -> DEL N N silent_mutation Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1208009403 C -> T LOC_Os12g14110.1 upstream_gene_variant ; 4904.0bp to feature; MODIFIER silent_mutation Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1208009403 C -> T LOC_Os12g14120.1 downstream_gene_variant ; 2424.0bp to feature; MODIFIER silent_mutation Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1208009403 C -> T LOC_Os12g14110-LOC_Os12g14120 intergenic_region ; MODIFIER silent_mutation Average:27.049; most accessible tissue: Minghui63 root, score: 40.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208009403 NA 8.84E-07 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 1.33E-06 1.33E-06 mr1144 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 1.88E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 3.08E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 9.45E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 3.47E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 4.92E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 1.88E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 2.27E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 2.91E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403 NA 3.70E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251