\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207996803:

Variant ID: vg1207996803 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7996803
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, A: 0.35, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ACAACACAAGATTTGGATAGAATCCATATGTGATGCGGATACAGGGGATAGGATGAAGATTTATGCCTTCTAGTGGCTGCAGTTTCTGTTTTTTTTTTCT[C/A]
TGCTGAATCTTGTTCCCTTTTGCTGTAAGACTGTTAAAGACTTTGTATTCTTATTTCGTTAATGAAATGGGAGAGGTCTATCCTCTCTTTCTAAAAAAAA

Reverse complement sequence

TTTTTTTTAGAAAGAGAGGATAGACCTCTCCCATTTCATTAACGAAATAAGAATACAAAGTCTTTAACAGTCTTACAGCAAAAGGGAACAAGATTCAGCA[G/T]
AGAAAAAAAAAACAGAAACTGCAGCCACTAGAAGGCATAAATCTTCATCCTATCCCCTGTATCCGCATCACATATGGATTCTATCCAAATCTTGTGTTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.60% 0.15% 0.00% NA
All Indica  2759 91.10% 8.80% 0.14% 0.00% NA
All Japonica  1512 5.30% 94.60% 0.07% 0.00% NA
Aus  269 67.30% 32.70% 0.00% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 88.10% 11.90% 0.00% 0.00% NA
Indica Intermediate  786 88.70% 11.10% 0.25% 0.00% NA
Temperate Japonica  767 6.10% 93.90% 0.00% 0.00% NA
Tropical Japonica  504 4.60% 95.20% 0.20% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 53.10% 1.04% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207996803 C -> A LOC_Os12g14080.1 upstream_gene_variant ; 2081.0bp to feature; MODIFIER silent_mutation Average:56.606; most accessible tissue: Callus, score: 79.634 N N N N
vg1207996803 C -> A LOC_Os12g14100.1 upstream_gene_variant ; 580.0bp to feature; MODIFIER silent_mutation Average:56.606; most accessible tissue: Callus, score: 79.634 N N N N
vg1207996803 C -> A LOC_Os12g14080.2 upstream_gene_variant ; 2081.0bp to feature; MODIFIER silent_mutation Average:56.606; most accessible tissue: Callus, score: 79.634 N N N N
vg1207996803 C -> A LOC_Os12g14070.1 downstream_gene_variant ; 4850.0bp to feature; MODIFIER silent_mutation Average:56.606; most accessible tissue: Callus, score: 79.634 N N N N
vg1207996803 C -> A LOC_Os12g14090.1 downstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:56.606; most accessible tissue: Callus, score: 79.634 N N N N
vg1207996803 C -> A LOC_Os12g14110.1 downstream_gene_variant ; 3694.0bp to feature; MODIFIER silent_mutation Average:56.606; most accessible tissue: Callus, score: 79.634 N N N N
vg1207996803 C -> A LOC_Os12g14090-LOC_Os12g14100 intergenic_region ; MODIFIER silent_mutation Average:56.606; most accessible tissue: Callus, score: 79.634 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207996803 NA 1.03E-27 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803 NA 3.24E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803 1.74E-07 NA mr1244_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803 NA 6.40E-26 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803 NA 9.68E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803 NA 1.63E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803 NA 8.78E-10 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803 NA 1.71E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251