Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207996803:

Variant ID: vg1207996803 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7996803
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, A: 0.35, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ACAACACAAGATTTGGATAGAATCCATATGTGATGCGGATACAGGGGATAGGATGAAGATTTATGCCTTCTAGTGGCTGCAGTTTCTGTTTTTTTTTTCT[C/A]
TGCTGAATCTTGTTCCCTTTTGCTGTAAGACTGTTAAAGACTTTGTATTCTTATTTCGTTAATGAAATGGGAGAGGTCTATCCTCTCTTTCTAAAAAAAA

Reverse complement sequence

TTTTTTTTAGAAAGAGAGGATAGACCTCTCCCATTTCATTAACGAAATAAGAATACAAAGTCTTTAACAGTCTTACAGCAAAAGGGAACAAGATTCAGCA[G/T]
AGAAAAAAAAAACAGAAACTGCAGCCACTAGAAGGCATAAATCTTCATCCTATCCCCTGTATCCGCATCACATATGGATTCTATCCAAATCTTGTGTTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	39.60%	0.15%	0.00%	NA
All Indica	2759	91.10%	8.80%	0.14%	0.00%	NA
All Japonica	1512	5.30%	94.60%	0.07%	0.00%	NA
Aus	269	67.30%	32.70%	0.00%	0.00%	NA
Indica I	595	97.00%	2.70%	0.34%	0.00%	NA
Indica II	465	93.50%	6.50%	0.00%	0.00%	NA
Indica III	913	88.10%	11.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.70%	11.10%	0.25%	0.00%	NA
Temperate Japonica	767	6.10%	93.90%	0.00%	0.00%	NA
Tropical Japonica	504	4.60%	95.20%	0.20%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	45.80%	53.10%	1.04%	0.00%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207996803	C -> A	LOC_Os12g14080.1	upstream_gene_variant ; 2081.0bp to feature; MODIFIER	silent_mutation	Average:56.606; most accessible tissue: Callus, score: 79.634	N	N	N	N
vg1207996803	C -> A	LOC_Os12g14100.1	upstream_gene_variant ; 580.0bp to feature; MODIFIER	silent_mutation	Average:56.606; most accessible tissue: Callus, score: 79.634	N	N	N	N
vg1207996803	C -> A	LOC_Os12g14080.2	upstream_gene_variant ; 2081.0bp to feature; MODIFIER	silent_mutation	Average:56.606; most accessible tissue: Callus, score: 79.634	N	N	N	N
vg1207996803	C -> A	LOC_Os12g14070.1	downstream_gene_variant ; 4850.0bp to feature; MODIFIER	silent_mutation	Average:56.606; most accessible tissue: Callus, score: 79.634	N	N	N	N
vg1207996803	C -> A	LOC_Os12g14090.1	downstream_gene_variant ; 81.0bp to feature; MODIFIER	silent_mutation	Average:56.606; most accessible tissue: Callus, score: 79.634	N	N	N	N
vg1207996803	C -> A	LOC_Os12g14110.1	downstream_gene_variant ; 3694.0bp to feature; MODIFIER	silent_mutation	Average:56.606; most accessible tissue: Callus, score: 79.634	N	N	N	N
vg1207996803	C -> A	LOC_Os12g14090-LOC_Os12g14100	intergenic_region ; MODIFIER	silent_mutation	Average:56.606; most accessible tissue: Callus, score: 79.634	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207996803	NA	1.03E-27	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803	NA	3.24E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803	1.74E-07	NA	mr1244_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803	NA	6.40E-26	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803	NA	9.68E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803	NA	1.63E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803	NA	8.78E-10	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207996803	NA	1.71E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251