\
| Variant ID: vg1207996803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7996803 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, A: 0.35, others allele: 0.00, population size: 94. )
ACAACACAAGATTTGGATAGAATCCATATGTGATGCGGATACAGGGGATAGGATGAAGATTTATGCCTTCTAGTGGCTGCAGTTTCTGTTTTTTTTTTCT[C/A]
TGCTGAATCTTGTTCCCTTTTGCTGTAAGACTGTTAAAGACTTTGTATTCTTATTTCGTTAATGAAATGGGAGAGGTCTATCCTCTCTTTCTAAAAAAAA
TTTTTTTTAGAAAGAGAGGATAGACCTCTCCCATTTCATTAACGAAATAAGAATACAAAGTCTTTAACAGTCTTACAGCAAAAGGGAACAAGATTCAGCA[G/T]
AGAAAAAAAAAACAGAAACTGCAGCCACTAGAAGGCATAAATCTTCATCCTATCCCCTGTATCCGCATCACATATGGATTCTATCCAAATCTTGTGTTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 39.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 91.10% | 8.80% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 5.30% | 94.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.70% | 11.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 6.10% | 93.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.60% | 95.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 53.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 65.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207996803 | C -> A | LOC_Os12g14080.1 | upstream_gene_variant ; 2081.0bp to feature; MODIFIER | silent_mutation | Average:56.606; most accessible tissue: Callus, score: 79.634 | N | N | N | N |
| vg1207996803 | C -> A | LOC_Os12g14100.1 | upstream_gene_variant ; 580.0bp to feature; MODIFIER | silent_mutation | Average:56.606; most accessible tissue: Callus, score: 79.634 | N | N | N | N |
| vg1207996803 | C -> A | LOC_Os12g14080.2 | upstream_gene_variant ; 2081.0bp to feature; MODIFIER | silent_mutation | Average:56.606; most accessible tissue: Callus, score: 79.634 | N | N | N | N |
| vg1207996803 | C -> A | LOC_Os12g14070.1 | downstream_gene_variant ; 4850.0bp to feature; MODIFIER | silent_mutation | Average:56.606; most accessible tissue: Callus, score: 79.634 | N | N | N | N |
| vg1207996803 | C -> A | LOC_Os12g14090.1 | downstream_gene_variant ; 81.0bp to feature; MODIFIER | silent_mutation | Average:56.606; most accessible tissue: Callus, score: 79.634 | N | N | N | N |
| vg1207996803 | C -> A | LOC_Os12g14110.1 | downstream_gene_variant ; 3694.0bp to feature; MODIFIER | silent_mutation | Average:56.606; most accessible tissue: Callus, score: 79.634 | N | N | N | N |
| vg1207996803 | C -> A | LOC_Os12g14090-LOC_Os12g14100 | intergenic_region ; MODIFIER | silent_mutation | Average:56.606; most accessible tissue: Callus, score: 79.634 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207996803 | NA | 1.03E-27 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207996803 | NA | 3.24E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207996803 | 1.74E-07 | NA | mr1244_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207996803 | NA | 6.40E-26 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207996803 | NA | 9.68E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207996803 | NA | 1.63E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207996803 | NA | 8.78E-10 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207996803 | NA | 1.71E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |