\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207987250:

Variant ID: vg1207987250 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7987250
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GTATTGATTTACCTGTTAGTATGTTGGTAGCTTGGAAACCTAAGTTCTATAATTATGCTCAAATGTGTGTAATGCCTAATCAGCTTAAGATGGTCATGTA[T/C]
TCATCTTGAACTTCTATCGGCAGTGAGGCAGTCTGAGTGATGGGAAGGAATCAACTAGTAAATCTTTTTCTTATAGTGCACCATTCTAAACTTGAAATGG

Reverse complement sequence

CCATTTCAAGTTTAGAATGGTGCACTATAAGAAAAAGATTTACTAGTTGATTCCTTCCCATCACTCAGACTGCCTCACTGCCGATAGAAGTTCAAGATGA[A/G]
TACATGACCATCTTAAGCTGATTAGGCATTACACACATTTGAGCATAATTATAGAACTTAGGTTTCCAAGCTACCAACATACTAACAGGTAAATCAATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 19.90% 0.99% 0.51% NA
All Indica  2759 87.90% 9.60% 1.63% 0.83% NA
All Japonica  1512 58.70% 41.30% 0.07% 0.00% NA
Aus  269 98.10% 1.50% 0.00% 0.37% NA
Indica I  595 80.50% 19.30% 0.17% 0.00% NA
Indica II  465 91.20% 8.60% 0.22% 0.00% NA
Indica III  913 90.50% 5.30% 2.85% 1.42% NA
Indica Intermediate  786 88.50% 8.00% 2.16% 1.27% NA
Temperate Japonica  767 34.20% 65.70% 0.13% 0.00% NA
Tropical Japonica  504 88.90% 11.10% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207987250 T -> C LOC_Os12g14059.1 downstream_gene_variant ; 4002.0bp to feature; MODIFIER silent_mutation Average:64.56; most accessible tissue: Callus, score: 82.556 N N N N
vg1207987250 T -> C LOC_Os12g14070.1 intron_variant ; MODIFIER silent_mutation Average:64.56; most accessible tissue: Callus, score: 82.556 N N N N
vg1207987250 T -> DEL N N silent_mutation Average:64.56; most accessible tissue: Callus, score: 82.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207987250 NA 8.28E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207987250 NA 2.19E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 7.73E-06 3.17E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 5.96E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 1.11E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 8.63E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 1.50E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 8.57E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 1.09E-07 1.34E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 7.66E-10 1.02E-20 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 1.31E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 2.33E-06 1.31E-15 mr1011_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 3.93E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 1.31E-18 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 9.27E-10 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 5.38E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 4.50E-06 9.15E-21 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 8.71E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 5.53E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 4.55E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 2.85E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207987250 NA 8.34E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251