\
| Variant ID: vg1207983341 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7983341 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 80. )
TTACCCTTATTTTTGATGACTTTTTTGCTTTCGAGTTGGGCTGCATCAGGTTCGATCTTCGACGAAGAGGTAAATCTTGTCATGGCGGCTTGCGTTCTCG[G/A]
GATTAGTGCTTACATCTTCATAACACTCTAATCTTGTCGACGCAAGTCGCTGAGTTATCATATATATCGCATGATATAGATCGATCTCATCATCTGAGCT
AGCTCAGATGATGAGATCGATCTATATCATGCGATATATATGATAACTCAGCGACTTGCGTCGACAAGATTAGAGTGTTATGAAGATGTAAGCACTAATC[C/T]
CGAGAACGCAAGCCGCCATGACAAGATTTACCTCTTCGTCGAAGATCGAACCTGATGCAGCCCAACTCGAAAGCAAAAAAGTCATCAAAAATAAGGGTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 22.20% | 2.96% | 20.40% | NA |
| All Indica | 2759 | 55.10% | 35.50% | 3.52% | 5.87% | NA |
| All Japonica | 1512 | 48.50% | 3.80% | 1.26% | 46.43% | NA |
| Aus | 269 | 70.60% | 0.40% | 7.06% | 21.93% | NA |
| Indica I | 595 | 42.50% | 45.90% | 3.03% | 8.57% | NA |
| Indica II | 465 | 45.60% | 50.30% | 1.08% | 3.01% | NA |
| Indica III | 913 | 66.20% | 24.80% | 4.49% | 4.60% | NA |
| Indica Intermediate | 786 | 57.40% | 31.40% | 4.20% | 7.00% | NA |
| Temperate Japonica | 767 | 71.30% | 6.10% | 0.78% | 21.77% | NA |
| Tropical Japonica | 504 | 20.60% | 1.20% | 1.79% | 76.39% | NA |
| Japonica Intermediate | 241 | 34.00% | 2.10% | 1.66% | 62.24% | NA |
| VI/Aromatic | 96 | 72.90% | 0.00% | 0.00% | 27.08% | NA |
| Intermediate | 90 | 66.70% | 11.10% | 5.56% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207983341 | G -> DEL | N | N | silent_mutation | Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg1207983341 | G -> A | LOC_Os12g14070.1 | upstream_gene_variant ; 2820.0bp to feature; MODIFIER | silent_mutation | Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg1207983341 | G -> A | LOC_Os12g14059.1 | downstream_gene_variant ; 93.0bp to feature; MODIFIER | silent_mutation | Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg1207983341 | G -> A | LOC_Os12g14059-LOC_Os12g14070 | intergenic_region ; MODIFIER | silent_mutation | Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207983341 | NA | 2.20E-07 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207983341 | NA | 5.76E-06 | mr1558 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207983341 | NA | 2.47E-07 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207983341 | NA | 1.58E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207983341 | NA | 5.04E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207983341 | NA | 2.61E-06 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207983341 | 1.07E-06 | 5.45E-14 | mr1864_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207983341 | 1.68E-06 | 2.11E-11 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |