\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207983341:

Variant ID: vg1207983341 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7983341
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TTACCCTTATTTTTGATGACTTTTTTGCTTTCGAGTTGGGCTGCATCAGGTTCGATCTTCGACGAAGAGGTAAATCTTGTCATGGCGGCTTGCGTTCTCG[G/A]
GATTAGTGCTTACATCTTCATAACACTCTAATCTTGTCGACGCAAGTCGCTGAGTTATCATATATATCGCATGATATAGATCGATCTCATCATCTGAGCT

Reverse complement sequence

AGCTCAGATGATGAGATCGATCTATATCATGCGATATATATGATAACTCAGCGACTTGCGTCGACAAGATTAGAGTGTTATGAAGATGTAAGCACTAATC[C/T]
CGAGAACGCAAGCCGCCATGACAAGATTTACCTCTTCGTCGAAGATCGAACCTGATGCAGCCCAACTCGAAAGCAAAAAAGTCATCAAAAATAAGGGTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 22.20% 2.96% 20.40% NA
All Indica  2759 55.10% 35.50% 3.52% 5.87% NA
All Japonica  1512 48.50% 3.80% 1.26% 46.43% NA
Aus  269 70.60% 0.40% 7.06% 21.93% NA
Indica I  595 42.50% 45.90% 3.03% 8.57% NA
Indica II  465 45.60% 50.30% 1.08% 3.01% NA
Indica III  913 66.20% 24.80% 4.49% 4.60% NA
Indica Intermediate  786 57.40% 31.40% 4.20% 7.00% NA
Temperate Japonica  767 71.30% 6.10% 0.78% 21.77% NA
Tropical Japonica  504 20.60% 1.20% 1.79% 76.39% NA
Japonica Intermediate  241 34.00% 2.10% 1.66% 62.24% NA
VI/Aromatic  96 72.90% 0.00% 0.00% 27.08% NA
Intermediate  90 66.70% 11.10% 5.56% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207983341 G -> DEL N N silent_mutation Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1207983341 G -> A LOC_Os12g14070.1 upstream_gene_variant ; 2820.0bp to feature; MODIFIER silent_mutation Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1207983341 G -> A LOC_Os12g14059.1 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1207983341 G -> A LOC_Os12g14059-LOC_Os12g14070 intergenic_region ; MODIFIER silent_mutation Average:55.696; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207983341 NA 2.20E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207983341 NA 5.76E-06 mr1558 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207983341 NA 2.47E-07 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207983341 NA 1.58E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207983341 NA 5.04E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207983341 NA 2.61E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207983341 1.07E-06 5.45E-14 mr1864_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207983341 1.68E-06 2.11E-11 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251