\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207982009:

Variant ID: vg1207982009 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7982009
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTTACTGTTTTGCTCAATAAAATGTTTTACAACCGCCTTTATGCAAATAGCCACAAGACATCCTTGTATCCCCTTGCACGTCTGCATCGTTTGTGT[A/G]
GTTTGCTGAGTATGGTGGTTATACTCAGCCTTGCTATTGTTCCCCCTTTTCAGAAGTGTAGAGCTTCTGAGCTGAAGACGAAGTTATAGGACCAAGGCTC

Reverse complement sequence

GAGCCTTGGTCCTATAACTTCGTCTTCAGCTCAGAAGCTCTACACTTCTGAAAAGGGGGAACAATAGCAAGGCTGAGTATAACCACCATACTCAGCAAAC[T/C]
ACACAAACGATGCAGACGTGCAAGGGGATACAAGGATGTCTTGTGGCTATTTGCATAAAGGCGGTTGTAAAACATTTTATTGAGCAAAACAGTAAAAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 17.40% 0.42% 25.90% NA
All Indica  2759 83.70% 3.00% 0.29% 13.05% NA
All Japonica  1512 6.20% 44.80% 0.73% 48.28% NA
Aus  269 66.20% 3.30% 0.00% 30.48% NA
Indica I  595 78.50% 4.90% 0.34% 16.30% NA
Indica II  465 90.30% 4.10% 0.00% 5.59% NA
Indica III  913 86.20% 0.70% 0.33% 12.81% NA
Indica Intermediate  786 80.70% 3.70% 0.38% 15.27% NA
Temperate Japonica  767 7.30% 69.60% 0.39% 22.69% NA
Tropical Japonica  504 5.40% 14.10% 1.39% 79.17% NA
Japonica Intermediate  241 4.10% 30.30% 0.41% 65.15% NA
VI/Aromatic  96 46.90% 21.90% 0.00% 31.25% NA
Intermediate  90 40.00% 34.40% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207982009 A -> DEL N N silent_mutation Average:56.99; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1207982009 A -> G LOC_Os12g14070.1 upstream_gene_variant ; 4152.0bp to feature; MODIFIER silent_mutation Average:56.99; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N
vg1207982009 A -> G LOC_Os12g14059.1 intron_variant ; MODIFIER silent_mutation Average:56.99; most accessible tissue: Minghui63 flag leaf, score: 81.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207982009 NA 4.05E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 5.31E-09 3.05E-12 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 6.16E-26 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 3.38E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 2.84E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 5.69E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 5.31E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 1.86E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 1.66E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207982009 NA 1.65E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251