\
| Variant ID: vg1207982009 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7982009 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTTTTTACTGTTTTGCTCAATAAAATGTTTTACAACCGCCTTTATGCAAATAGCCACAAGACATCCTTGTATCCCCTTGCACGTCTGCATCGTTTGTGT[A/G]
GTTTGCTGAGTATGGTGGTTATACTCAGCCTTGCTATTGTTCCCCCTTTTCAGAAGTGTAGAGCTTCTGAGCTGAAGACGAAGTTATAGGACCAAGGCTC
GAGCCTTGGTCCTATAACTTCGTCTTCAGCTCAGAAGCTCTACACTTCTGAAAAGGGGGAACAATAGCAAGGCTGAGTATAACCACCATACTCAGCAAAC[T/C]
ACACAAACGATGCAGACGTGCAAGGGGATACAAGGATGTCTTGTGGCTATTTGCATAAAGGCGGTTGTAAAACATTTTATTGAGCAAAACAGTAAAAACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.30% | 17.40% | 0.42% | 25.90% | NA |
| All Indica | 2759 | 83.70% | 3.00% | 0.29% | 13.05% | NA |
| All Japonica | 1512 | 6.20% | 44.80% | 0.73% | 48.28% | NA |
| Aus | 269 | 66.20% | 3.30% | 0.00% | 30.48% | NA |
| Indica I | 595 | 78.50% | 4.90% | 0.34% | 16.30% | NA |
| Indica II | 465 | 90.30% | 4.10% | 0.00% | 5.59% | NA |
| Indica III | 913 | 86.20% | 0.70% | 0.33% | 12.81% | NA |
| Indica Intermediate | 786 | 80.70% | 3.70% | 0.38% | 15.27% | NA |
| Temperate Japonica | 767 | 7.30% | 69.60% | 0.39% | 22.69% | NA |
| Tropical Japonica | 504 | 5.40% | 14.10% | 1.39% | 79.17% | NA |
| Japonica Intermediate | 241 | 4.10% | 30.30% | 0.41% | 65.15% | NA |
| VI/Aromatic | 96 | 46.90% | 21.90% | 0.00% | 31.25% | NA |
| Intermediate | 90 | 40.00% | 34.40% | 1.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207982009 | A -> DEL | N | N | silent_mutation | Average:56.99; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| vg1207982009 | A -> G | LOC_Os12g14070.1 | upstream_gene_variant ; 4152.0bp to feature; MODIFIER | silent_mutation | Average:56.99; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| vg1207982009 | A -> G | LOC_Os12g14059.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.99; most accessible tissue: Minghui63 flag leaf, score: 81.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207982009 | NA | 4.05E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | 5.31E-09 | 3.05E-12 | mr1334_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 6.16E-26 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 3.38E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 2.84E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 5.69E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 5.31E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 1.86E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 1.66E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207982009 | NA | 1.65E-19 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |