Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207955286:

Variant ID: vg1207955286 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7955286
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CATGTCACAACAACCTCAAGGAGCACCTCAACAACAACCATGGGCCGATATGATTGCGGATGTGATGAAGGAGAAGTTTGGGCTTAGGCCGAAAGACGCT[G/A]
GAAATTTGTACCGGTAGCCTTACCCTGAATGGTTTGAGAGAGTCCCTCTACCTAATCAGTTCAAAGTTCCAGATTTTTCAAAATTCTCAGGGCAGGATAG

Reverse complement sequence

CTATCCTGCCCTGAGAATTTTGAAAAATCTGGAACTTTGAACTGATTAGGTAGAGGGACTCTCTCAAACCATTCAGGGTAAGGCTACCGGTACAAATTTC[C/T]
AGCGTCTTTCGGCCTAAGCCCAAACTTCTCCTTCATCACATCCGCAATCATATCGGCCCATGGTTGTTGTTGAGGTGCTCCTTGAGGTTGTTGTGACATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	33.70%	3.58%	22.18%	NA
All Indica	2759	39.50%	47.40%	3.62%	9.50%	NA
All Japonica	1512	48.20%	2.40%	2.58%	46.83%	NA
Aus	269	5.20%	67.30%	6.69%	20.82%	NA
Indica I	595	51.80%	31.60%	3.53%	13.11%	NA
Indica II	465	55.90%	37.80%	1.94%	4.30%	NA
Indica III	913	25.70%	62.10%	3.94%	8.21%	NA
Indica Intermediate	786	36.40%	48.00%	4.33%	11.32%	NA
Temperate Japonica	767	74.80%	0.90%	1.56%	22.69%	NA
Tropical Japonica	504	15.10%	5.00%	2.38%	77.58%	NA
Japonica Intermediate	241	32.80%	1.70%	6.22%	59.34%	NA
VI/Aromatic	96	38.50%	46.90%	6.25%	8.33%	NA
Intermediate	90	51.10%	26.70%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207955286	G -> DEL	LOC_Os12g13990.1	N	frameshift_variant	Average:57.27; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg1207955286	G -> A	LOC_Os12g13990.1	missense_variant ; p.Gly535Arg; MODERATE	nonsynonymous_codon ; G535R	Average:57.27; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	unknown	unknown	TOLERATED	0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207955286	NA	6.65E-06	mr1014	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	9.12E-08	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	5.35E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	3.88E-09	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	4.05E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	1.03E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	2.74E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	7.37E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	4.94E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207955286	NA	1.12E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251