\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207916494:

Variant ID: vg1207916494 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7916494
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, T: 0.23, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGTTATTGCATTTGCTGCAAGGCCTTATACTGAACTTGCACTCCCTAAATTTACTACAATCTTTTATTTTATTTTATTTTCATGATTCCACCTTAGAT[A/T]
TGTTTTTATAATTTTGGTGAAAATCCACGAAATCAAGTAGAAGTTTTTGACTAGATGTTCCAATAACTATTTTGTTATTTATGATTCACCTGAAATTTTC

Reverse complement sequence

GAAAATTTCAGGTGAATCATAAATAACAAAATAGTTATTGGAACATCTAGTCAAAAACTTCTACTTGATTTCGTGGATTTTCACCAAAATTATAAAAACA[T/A]
ATCTAAGGTGGAATCATGAAAATAAAATAAAATAAAAGATTGTAGTAAATTTAGGGAGTGCAAGTTCAGTATAAGGCCTTGCAGCAAATGCAATAACCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 26.40% 0.11% 0.00% NA
All Indica  2759 84.20% 15.70% 0.14% 0.00% NA
All Japonica  1512 57.10% 42.80% 0.07% 0.00% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 78.20% 21.80% 0.00% 0.00% NA
Indica II  465 89.90% 10.10% 0.00% 0.00% NA
Indica III  913 87.20% 12.60% 0.22% 0.00% NA
Indica Intermediate  786 81.80% 17.90% 0.25% 0.00% NA
Temperate Japonica  767 30.80% 69.10% 0.13% 0.00% NA
Tropical Japonica  504 89.30% 10.70% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207916494 A -> T LOC_Os12g13940.1 upstream_gene_variant ; 2983.0bp to feature; MODIFIER silent_mutation Average:54.765; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1207916494 A -> T LOC_Os12g13920.1 downstream_gene_variant ; 2635.0bp to feature; MODIFIER silent_mutation Average:54.765; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1207916494 A -> T LOC_Os12g13930.1 intron_variant ; MODIFIER silent_mutation Average:54.765; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207916494 8.99E-07 2.00E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 6.48E-08 3.79E-15 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 6.89E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 7.15E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.17E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.65E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 9.18E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 9.41E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 1.12E-10 5.57E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 8.28E-12 7.84E-23 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 2.08E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.49E-13 mr1011_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.42E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.06E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.55E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.27E-18 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.32E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 2.87E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 3.26E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 1.12E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207916494 NA 6.69E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251