\
| Variant ID: vg1207888547 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7888547 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.23, others allele: 0.00, population size: 70. )
TAAATCGCGAGACGAATCTTTTGAGCCTAATTAGGCCATGATTAGCCATAAGTGCTACAGTAACCCACATGTGCTAATGCCAGCTTAAGTAGGCTCAAAA[T/G]
ATTCGTCTCGCGGTTTCCAGGCGAGTTCTGAAATTAGTTTTTTCATTCGTGTCCGAAAACCCCTTCCGACATTCGGTCAAACGTCTGATGTGACACCTAA
TTAGGTGTCACATCAGACGTTTGACCGAATGTCGGAAGGGGTTTTCGGACACGAATGAAAAAACTAATTTCAGAACTCGCCTGGAAACCGCGAGACGAAT[A/C]
TTTTGAGCCTACTTAAGCTGGCATTAGCACATGTGGGTTACTGTAGCACTTATGGCTAATCATGGCCTAATTAGGCTCAAAAGATTCGTCTCGCGATTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 18.90% | 17.80% | 0.53% | 62.82% | NA |
| All Indica | 2759 | 2.90% | 4.20% | 0.65% | 92.24% | NA |
| All Japonica | 1512 | 50.00% | 45.20% | 0.26% | 4.56% | NA |
| Aus | 269 | 1.90% | 1.90% | 0.74% | 95.54% | NA |
| Indica I | 595 | 3.00% | 0.70% | 1.51% | 94.79% | NA |
| Indica II | 465 | 3.70% | 1.70% | 0.65% | 93.98% | NA |
| Indica III | 913 | 1.20% | 5.60% | 0.11% | 93.10% | NA |
| Indica Intermediate | 786 | 4.30% | 6.70% | 0.64% | 88.30% | NA |
| Temperate Japonica | 767 | 70.80% | 23.10% | 0.52% | 5.61% | NA |
| Tropical Japonica | 504 | 27.80% | 68.30% | 0.00% | 3.97% | NA |
| Japonica Intermediate | 241 | 30.30% | 67.20% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 22.90% | 8.30% | 1.04% | 67.71% | NA |
| Intermediate | 90 | 32.20% | 31.10% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207888547 | T -> DEL | N | N | silent_mutation | Average:15.424; most accessible tissue: Callus, score: 74.87 | N | N | N | N |
| vg1207888547 | T -> G | LOC_Os12g13910.1 | upstream_gene_variant ; 3828.0bp to feature; MODIFIER | silent_mutation | Average:15.424; most accessible tissue: Callus, score: 74.87 | N | N | N | N |
| vg1207888547 | T -> G | LOC_Os12g13900-LOC_Os12g13910 | intergenic_region ; MODIFIER | silent_mutation | Average:15.424; most accessible tissue: Callus, score: 74.87 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207888547 | NA | 2.24E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207888547 | NA | 3.57E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207888547 | 2.50E-12 | 3.29E-18 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | 3.28E-10 | 4.89E-19 | mr1002 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 2.11E-12 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 3.18E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | 1.07E-21 | 8.79E-29 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | 3.01E-19 | 1.20E-32 | mr1002_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 1.07E-12 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 3.42E-08 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 2.79E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 6.73E-08 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 5.83E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 3.20E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207888547 | NA | 8.43E-07 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |