\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207863655:

Variant ID: vg1207863655 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7863655
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTTTGAAAAGGAAAAGGGGATTATTGCGTCAGCGACTAGGGTACACGGTGGACCAGGTGCACGGCGGCGGCTCACGGAAACGAACGGTCGGGATC[G/T]
ATCTATCCAAAACGAACGGCCGAGATCTAACGGTCCACGACCGGTCTACGACGGACGGCAACAATGACGTCAGCGATGACGTCATCACCGGCGACGGCTC

Reverse complement sequence

GAGCCGTCGCCGGTGATGACGTCATCGCTGACGTCATTGTTGCCGTCCGTCGTAGACCGGTCGTGGACCGTTAGATCTCGGCCGTTCGTTTTGGATAGAT[C/A]
GATCCCGACCGTTCGTTTCCGTGAGCCGCCGCCGTGCACCTGGTCCACCGTGTACCCTAGTCGCTGACGCAATAATCCCCTTTTCCTTTTCAAAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 1.70% 2.77% 4.61% NA
All Indica  2759 89.90% 0.30% 3.01% 6.74% NA
All Japonica  1512 97.90% 0.00% 0.13% 1.98% NA
Aus  269 61.30% 24.90% 13.75% 0.00% NA
Indica I  595 91.30% 0.20% 2.69% 5.88% NA
Indica II  465 82.80% 0.00% 5.16% 12.04% NA
Indica III  913 93.20% 0.50% 1.42% 4.82% NA
Indica Intermediate  786 89.30% 0.40% 3.82% 6.49% NA
Temperate Japonica  767 96.20% 0.00% 0.13% 3.65% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 2.10% 5.21% 0.00% NA
Intermediate  90 92.20% 1.10% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207863655 G -> DEL N N silent_mutation Average:31.542; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg1207863655 G -> T LOC_Os12g13870.1 downstream_gene_variant ; 4912.0bp to feature; MODIFIER silent_mutation Average:31.542; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg1207863655 G -> T LOC_Os12g13880.1 downstream_gene_variant ; 2607.0bp to feature; MODIFIER silent_mutation Average:31.542; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg1207863655 G -> T LOC_Os12g13870-LOC_Os12g13880 intergenic_region ; MODIFIER silent_mutation Average:31.542; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207863655 NA 3.15E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 9.04E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 7.83E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 1.10E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 3.57E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 2.69E-07 NA mr1155 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 2.01E-08 1.15E-09 mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 4.51E-06 NA mr1196 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 4.52E-06 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 5.42E-06 NA mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 4.27E-06 4.27E-06 mr1481 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 5.23E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 3.45E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 2.90E-07 8.95E-08 mr1600 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 4.96E-07 2.99E-08 mr1600 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 5.65E-07 NA mr1637 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 7.93E-08 9.31E-08 mr1637 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 9.42E-06 mr1704 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 4.20E-06 mr1727 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 3.37E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 1.28E-07 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207863655 NA 9.15E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251