\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207849594:

Variant ID: vg1207849594 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7849594
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGTTGGAGGATTGTTGTGTGTATCCAAGGTAGTGATGTCCGCATCACCACCATACCCTGACCCATACCCTGACCCCCCACCACCACCTTCACCCCCTC[C/A]
CCCGCCACCACCTTCACCACCACCGCCGCCACCTCCCTCAGTTGTGTATCTAGCTACTCTTGCTGCATTGGACAAGCCAATGCTCACAAGCAGAACAAAG

Reverse complement sequence

CTTTGTTCTGCTTGTGAGCATTGGCTTGTCCAATGCAGCAAGAGTAGCTAGATACACAACTGAGGGAGGTGGCGGCGGTGGTGGTGAAGGTGGTGGCGGG[G/T]
GAGGGGGTGAAGGTGGTGGTGGGGGGTCAGGGTATGGGTCAGGGTATGGTGGTGATGCGGACATCACTACCTTGGATACACACAACAATCCTCCAACGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 37.90% 0.76% 6.07% NA
All Indica  2759 80.60% 9.20% 0.40% 9.79% NA
All Japonica  1512 4.40% 95.20% 0.26% 0.13% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 67.90% 4.20% 0.17% 27.73% NA
Indica II  465 87.30% 7.10% 0.65% 4.95% NA
Indica III  913 85.90% 9.90% 0.44% 3.83% NA
Indica Intermediate  786 80.00% 13.60% 0.38% 5.98% NA
Temperate Japonica  767 5.90% 94.00% 0.00% 0.13% NA
Tropical Japonica  504 3.60% 95.80% 0.40% 0.20% NA
Japonica Intermediate  241 1.20% 97.90% 0.83% 0.00% NA
VI/Aromatic  96 34.40% 30.20% 20.83% 14.58% NA
Intermediate  90 36.70% 62.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207849594 C -> DEL LOC_Os12g13860.1 N frameshift_variant Average:67.627; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg1207849594 C -> A LOC_Os12g13860.1 N stop_gained Average:67.627; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207849594 8.34E-09 2.52E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 4.23E-07 1.98E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 1.53E-07 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 5.61E-06 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 7.70E-06 NA mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 9.97E-07 NA mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 2.64E-06 NA mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 4.47E-06 NA mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 7.01E-32 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 1.27E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 2.27E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 7.93E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 1.06E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 2.94E-13 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 7.04E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 2.33E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 4.87E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 5.05E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 3.01E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 7.28E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 5.85E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 1.65E-06 mr1705_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 5.62E-13 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 7.42E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 2.21E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 2.81E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 3.18E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207849594 NA 1.81E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251