\
| Variant ID: vg1207844031 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7844031 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 92. )
GCCTCGTCGCGTGGTGGTAAGGATCCCTCTCCCTCGCTGCCCCGTCCTCGTCCTTTCGGTGTCGCCCGTGCCCGTTGTGCGGTTGTCGGCCCCGGTACCC[A/G]
TGTATCGGTGTCGGCAGTCGTTCGCTTGTGCGTGTGGTGACCGTGTTAGTGTGTCCGCTCGGTAGCCGCGTGGTTTCCACGTGTGCAGCCCGTGTGGTGT
ACACCACACGGGCTGCACACGTGGAAACCACGCGGCTACCGAGCGGACACACTAACACGGTCACCACACGCACAAGCGAACGACTGCCGACACCGATACA[T/C]
GGGTACCGGGGCCGACAACCGCACAACGGGCACGGGCGACACCGAAAGGACGAGGACGGGGCAGCGAGGGAGAGGGATCCTTACCACCACGCGACGAGGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.60% | 14.10% | 40.27% | 0.00% | NA |
| All Indica | 2759 | 21.20% | 21.10% | 57.70% | 0.00% | NA |
| All Japonica | 1512 | 95.40% | 1.60% | 2.98% | 0.00% | NA |
| Aus | 269 | 12.60% | 17.50% | 69.89% | 0.00% | NA |
| Indica I | 595 | 17.50% | 10.60% | 71.93% | 0.00% | NA |
| Indica II | 465 | 23.70% | 10.50% | 65.81% | 0.00% | NA |
| Indica III | 913 | 19.90% | 34.70% | 45.35% | 0.00% | NA |
| Indica Intermediate | 786 | 23.90% | 19.60% | 56.49% | 0.00% | NA |
| Temperate Japonica | 767 | 93.70% | 2.90% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 0.40% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 35.40% | 5.20% | 59.38% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 7.80% | 23.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207844031 | A -> G | LOC_Os12g13860.1 | downstream_gene_variant ; 4190.0bp to feature; MODIFIER | silent_mutation | Average:17.251; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 | N | N | N | N |
| vg1207844031 | A -> G | LOC_Os12g13850-LOC_Os12g13860 | intergenic_region ; MODIFIER | silent_mutation | Average:17.251; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207844031 | NA | 7.66E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207844031 | 5.59E-07 | 5.62E-07 | mr1258 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207844031 | 1.14E-07 | 1.14E-07 | mr1258 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207844031 | 4.87E-06 | 4.87E-06 | mr1545 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207844031 | 4.49E-06 | 9.97E-06 | mr1974 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207844031 | 9.25E-07 | 9.10E-06 | mr1974 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |