\
| Variant ID: vg1207833484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7833484 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCTTATTGTGAACCGGCACATATGGACTCATATTTGGTGATTTTTGTTAAGAAAACAGGACATGCATCACCCATATATGCCAGTTCACAATATAAACCA[G/A]
CACATATGGTGCTGCACTCATATGTGCCAGTTCCATATGTGATCAATAAAAACCAGCGCACATAATAAATGTGCCTGTTTTTGTTAAGAACCGGCATATA
TATATGCCGGTTCTTAACAAAAACAGGCACATTTATTATGTGCGCTGGTTTTTATTGATCACATATGGAACTGGCACATATGAGTGCAGCACCATATGTG[C/T]
TGGTTTATATTGTGAACTGGCATATATGGGTGATGCATGTCCTGTTTTCTTAACAAAAATCACCAAATATGAGTCCATATGTGCCGGTTCACAATAAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 86.80% | 13.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.80% | 17.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207833484 | G -> A | LOC_Os12g13840.1 | upstream_gene_variant ; 1058.0bp to feature; MODIFIER | silent_mutation | Average:46.265; most accessible tissue: Callus, score: 82.206 | N | N | N | N |
| vg1207833484 | G -> A | LOC_Os12g13850.1 | upstream_gene_variant ; 609.0bp to feature; MODIFIER | silent_mutation | Average:46.265; most accessible tissue: Callus, score: 82.206 | N | N | N | N |
| vg1207833484 | G -> A | LOC_Os12g13840-LOC_Os12g13850 | intergenic_region ; MODIFIER | silent_mutation | Average:46.265; most accessible tissue: Callus, score: 82.206 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207833484 | NA | 9.32E-07 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | NA | 1.11E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | NA | 7.20E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 2.72E-06 | 2.22E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 3.95E-06 | NA | mr1131 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 3.25E-06 | 3.22E-08 | mr1131 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | NA | 6.45E-08 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 3.93E-08 | NA | mr1199 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 4.30E-08 | 3.27E-08 | mr1199 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | NA | 3.69E-10 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 4.40E-06 | NA | mr1233 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 2.96E-06 | 8.59E-08 | mr1233 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 6.88E-06 | NA | mr1436 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 1.81E-06 | 4.76E-06 | mr1436 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 8.56E-06 | NA | mr1620 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 3.06E-06 | 5.74E-08 | mr1620 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | NA | 4.87E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 1.07E-06 | NA | mr1878 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | 6.96E-08 | 5.38E-08 | mr1878 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | NA | 6.11E-08 | mr1888 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207833484 | NA | 2.04E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |