\
| Variant ID: vg1207827697 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7827697 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 105. )
AAGTAGTAGAATCACCATGCCAATCCACCGGTAATCCTGACTTGAGTGTTTTCCTTTTCACAGCTTCACCATGAGCCATCCAACGAGCCTACGCCAGACC[G/C]
GCCACCTTTAAGAGACTATGCTATCTCTGTAAATTCTTCTTCTGGACTCCACTTGCAATAGTGCTCCACTTTCTCTCCTATTATTACAGTCATCTTGCAA
TTGCAAGATGACTGTAATAATAGGAGAGAAAGTGGAGCACTATTGCAAGTGGAGTCCAGAAGAAGAATTTACAGAGATAGCATAGTCTCTTAAAGGTGGC[C/G]
GGTCTGGCGTAGGCTCGTTGGATGGCTCATGGTGAAGCTGTGAAAAGGAAAACACTCAAGTCAGGATTACCGGTGGATTGGCATGGTGATTCTACTACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 8.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.50% | 9.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207827697 | G -> C | LOC_Os12g13824.1 | upstream_gene_variant ; 2608.0bp to feature; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1207827697 | G -> C | LOC_Os12g13824.2 | upstream_gene_variant ; 2608.0bp to feature; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1207827697 | G -> C | LOC_Os12g13840.1 | downstream_gene_variant ; 4229.0bp to feature; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1207827697 | G -> C | LOC_Os12g13824-LOC_Os12g13840 | intergenic_region ; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207827697 | NA | 5.36E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207827697 | NA | 1.98E-49 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.11E-12 | 1.93E-17 | mr1016 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.66E-37 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.02E-10 | 4.03E-16 | mr1017 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 6.31E-06 | 2.38E-06 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 8.72E-07 | 8.11E-30 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 7.62E-13 | 1.10E-15 | mr1022 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 2.65E-07 | 7.42E-11 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 8.31E-34 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.06E-11 | 7.03E-15 | mr1055 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.67E-09 | 1.51E-14 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.02E-70 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.13E-09 | 3.36E-13 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 3.19E-07 | 2.37E-11 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.53E-58 | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 5.51E-10 | 7.83E-14 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 2.47E-57 | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 2.34E-10 | 1.73E-14 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.02E-55 | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 2.12E-09 | 2.30E-13 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 5.84E-08 | 2.94E-12 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 2.27E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 4.80E-34 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 3.60E-08 | 1.11E-13 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.88E-06 | 3.64E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.18E-25 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 2.23E-08 | 2.07E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 6.13E-06 | NA | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.05E-33 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 2.25E-78 | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.72E-06 | 4.71E-12 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 2.86E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.51E-19 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 6.39E-31 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 8.69E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 3.54E-20 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.37E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 2.66E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 4.39E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 2.25E-13 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 2.92E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.85E-22 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.60E-62 | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.36E-06 | 2.26E-12 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 3.68E-50 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 7.76E-08 | 2.38E-11 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 9.52E-65 | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 6.46E-07 | 8.13E-12 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 9.51E-16 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.41E-46 | mr1546_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 3.78E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.09E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 8.87E-12 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.90E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.45E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 9.28E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 7.73E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 9.87E-13 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 9.29E-21 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.56E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 6.24E-17 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 3.22E-66 | mr1889_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 9.57E-65 | mr1896_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.25E-12 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.94E-09 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.47E-09 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 1.50E-20 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |