| Variant ID: vg1207827697 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7827697 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 105. )
AAGTAGTAGAATCACCATGCCAATCCACCGGTAATCCTGACTTGAGTGTTTTCCTTTTCACAGCTTCACCATGAGCCATCCAACGAGCCTACGCCAGACC[G/C]
GCCACCTTTAAGAGACTATGCTATCTCTGTAAATTCTTCTTCTGGACTCCACTTGCAATAGTGCTCCACTTTCTCTCCTATTATTACAGTCATCTTGCAA
TTGCAAGATGACTGTAATAATAGGAGAGAAAGTGGAGCACTATTGCAAGTGGAGTCCAGAAGAAGAATTTACAGAGATAGCATAGTCTCTTAAAGGTGGC[C/G]
GGTCTGGCGTAGGCTCGTTGGATGGCTCATGGTGAAGCTGTGAAAAGGAAAACACTCAAGTCAGGATTACCGGTGGATTGGCATGGTGATTCTACTACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 8.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.50% | 9.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207827697 | G -> C | LOC_Os12g13824.1 | upstream_gene_variant ; 2608.0bp to feature; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1207827697 | G -> C | LOC_Os12g13824.2 | upstream_gene_variant ; 2608.0bp to feature; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1207827697 | G -> C | LOC_Os12g13840.1 | downstream_gene_variant ; 4229.0bp to feature; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1207827697 | G -> C | LOC_Os12g13824-LOC_Os12g13840 | intergenic_region ; MODIFIER | silent_mutation | Average:52.965; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207827697 | NA | 5.36E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207827697 | NA | 1.98E-49 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.11E-12 | 1.93E-17 | mr1016 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 5.66E-37 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 1.02E-10 | 4.03E-16 | mr1017 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 6.31E-06 | 2.38E-06 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 8.72E-07 | 8.11E-30 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 7.62E-13 | 1.10E-15 | mr1022 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | 2.65E-07 | 7.42E-11 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207827697 | NA | 8.31E-34 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/