\
| Variant ID: vg1207826504 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7826504 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 107. )
CGGATCCGTGCCGTCGTCGCCATCAAGGAGCTAGGGTTTTGATTTTCACGTGCGGGTGCACCACCCGCATGGAAAAATCACTATTTTCGCAAACCTTTTT[G/A]
GTAGAAGGGAGGTCCAAGTCCAACCGCATGAAAAAATAGGCTTTGGCCGCATGGAAAAATGGTATTTTTAGTAGTGTGTGGCACCCTACTGCGCAGCACC
GGTGCTGCGCAGTAGGGTGCCACACACTACTAAAAATACCATTTTTCCATGCGGCCAAAGCCTATTTTTTCATGCGGTTGGACTTGGACCTCCCTTCTAC[C/T]
AAAAAGGTTTGCGAAAATAGTGATTTTTCCATGCGGGTGGTGCACCCGCACGTGAAAATCAAAACCCTAGCTCCTTGATGGCGACGACGGCACGGATCCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.50% | 37.40% | 1.04% | 3.05% | NA |
| All Indica | 2759 | 86.20% | 8.50% | 1.38% | 3.95% | NA |
| All Japonica | 1512 | 4.30% | 95.20% | 0.13% | 0.33% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 85.40% | 3.40% | 1.51% | 9.75% | NA |
| Indica II | 465 | 91.20% | 5.60% | 2.15% | 1.08% | NA |
| Indica III | 913 | 86.10% | 9.40% | 1.42% | 3.07% | NA |
| Indica Intermediate | 786 | 83.80% | 13.10% | 0.76% | 2.29% | NA |
| Temperate Japonica | 767 | 5.70% | 94.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 3.60% | 96.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.50% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 33.30% | 32.30% | 5.21% | 29.17% | NA |
| Intermediate | 90 | 34.40% | 60.00% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207826504 | G -> DEL | N | N | silent_mutation | Average:68.925; most accessible tissue: Minghui63 flag leaf, score: 83.826 | N | N | N | N |
| vg1207826504 | G -> A | LOC_Os12g13824.1 | upstream_gene_variant ; 1415.0bp to feature; MODIFIER | silent_mutation | Average:68.925; most accessible tissue: Minghui63 flag leaf, score: 83.826 | N | N | N | N |
| vg1207826504 | G -> A | LOC_Os12g13824.2 | upstream_gene_variant ; 1415.0bp to feature; MODIFIER | silent_mutation | Average:68.925; most accessible tissue: Minghui63 flag leaf, score: 83.826 | N | N | N | N |
| vg1207826504 | G -> A | LOC_Os12g13824-LOC_Os12g13840 | intergenic_region ; MODIFIER | silent_mutation | Average:68.925; most accessible tissue: Minghui63 flag leaf, score: 83.826 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207826504 | NA | 5.98E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1207826504 | NA | 2.34E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 3.55E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.10E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 6.16E-26 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.26E-33 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | 3.90E-06 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.76E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.21E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.20E-20 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.29E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.14E-32 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.59E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 3.52E-21 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 3.67E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | 1.95E-06 | NA | mr1216_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 9.62E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.24E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.71E-19 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 8.55E-34 | mr1256_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 7.24E-14 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.01E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 5.19E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.22E-23 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 6.10E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.03E-50 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.11E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 2.59E-16 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.03E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 8.79E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | 5.23E-06 | NA | mr1591_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.79E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.15E-09 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.91E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 8.62E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.77E-09 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.13E-13 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.26E-16 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 3.31E-22 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 7.77E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 2.15E-16 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 3.04E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 3.19E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 7.00E-07 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.96E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 7.55E-33 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | 3.83E-06 | NA | mr1890_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 6.80E-13 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.42E-09 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 3.34E-09 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 9.85E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 1.63E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 4.35E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207826504 | NA | 2.68E-22 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |