Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1207816760:

Variant ID: vg1207816760 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7816760
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGCGACAATTTTTGGCAATTCCATTAAATTTAATTAGCCAATAACCAAATGGATGACACTAAACATTAGTTATGTTGTCCAACAGTAATTAATATTCC[A/G]
ATAGTAATTAATATTTGATAACTGTTGATAACTAGCTTAATTTAATTAGCAAATAACTAGGCATATATAGCCGCCGCCGCATAGTCCATCTAGACTGTCT

Reverse complement sequence

AGACAGTCTAGATGGACTATGCGGCGGCGGCTATATATGCCTAGTTATTTGCTAATTAAATTAAGCTAGTTATCAACAGTTATCAAATATTAATTACTAT[T/C]
GGAATATTAATTACTGTTGGACAACATAACTAATGTTTAGTGTCATCCATTTGGTTATTGGCTAATTAAATTTAATGGAATTGCCAAAAATTGTCGCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 38.40% 0.95% 0.04% NA
All Indica  2759 88.40% 9.90% 1.63% 0.07% NA
All Japonica  1512 4.70% 95.30% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 91.40% 6.20% 2.35% 0.00% NA
Indica II  465 90.50% 6.90% 2.58% 0.00% NA
Indica III  913 89.00% 10.00% 0.99% 0.00% NA
Indica Intermediate  786 84.10% 14.40% 1.27% 0.25% NA
Temperate Japonica  767 6.00% 94.00% 0.00% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207816760 A -> DEL N N silent_mutation Average:69.371; most accessible tissue: Zhenshan97 root, score: 90.417 N N N N
vg1207816760 A -> G LOC_Os12g13824.1 downstream_gene_variant ; 3192.0bp to feature; MODIFIER silent_mutation Average:69.371; most accessible tissue: Zhenshan97 root, score: 90.417 N N N N
vg1207816760 A -> G LOC_Os12g13824.2 downstream_gene_variant ; 3191.0bp to feature; MODIFIER silent_mutation Average:69.371; most accessible tissue: Zhenshan97 root, score: 90.417 N N N N
vg1207816760 A -> G LOC_Os12g13810-LOC_Os12g13824 intergenic_region ; MODIFIER silent_mutation Average:69.371; most accessible tissue: Zhenshan97 root, score: 90.417 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207816760 A G 0.11 0.06 0.05 0.02 0.07 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207816760 5.25E-09 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 8.45E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 1.14E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 7.77E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 4.00E-09 NA mr1022_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 3.44E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 8.52E-06 NA mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 1.15E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 3.93E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 4.72E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 2.24E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 4.08E-13 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 5.82E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 1.15E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 8.64E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 1.29E-11 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 2.93E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 5.59E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 2.30E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 8.43E-09 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 8.77E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207816760 NA 7.29E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251