Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207781630:

Variant ID: vg1207781630 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7781630
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATCGACATGACCGATTTGTGATTCGGTCTTAGGTGATAATGCTATTTCACTTTCACTTGTGATGCAATCCGAACCATCATCTAGTTCGGCTATATCTT[C/T]
AATGATGCTATTCTCTAAGCTATCAACACAATCCGAACCACCACTTGGTTCGGCTATTCCATTATTATCTAAACTAGTAACACAATCCGAACCGTCACCT

Reverse complement sequence

AGGTGACGGTTCGGATTGTGTTACTAGTTTAGATAATAATGGAATAGCCGAACCAAGTGGTGGTTCGGATTGTGTTGATAGCTTAGAGAATAGCATCATT[G/A]
AAGATATAGCCGAACTAGATGATGGTTCGGATTGCATCACAAGTGAAAGTGAAATAGCATTATCACCTAAGACCGAATCACAAATCGGTCATGTCGATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	0.70%	17.35%	8.91%	NA
All Indica	2759	62.20%	1.20%	25.26%	11.42%	NA
All Japonica	1512	96.60%	0.00%	0.60%	2.84%	NA
Aus	269	52.80%	0.40%	26.39%	20.45%	NA
Indica I	595	33.60%	1.20%	38.82%	26.39%	NA
Indica II	465	67.30%	0.40%	23.23%	9.03%	NA
Indica III	913	77.70%	2.10%	16.10%	4.16%	NA
Indica Intermediate	786	62.70%	0.50%	26.84%	9.92%	NA
Temperate Japonica	767	95.20%	0.00%	0.39%	4.43%	NA
Tropical Japonica	504	97.60%	0.00%	0.99%	1.39%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	63.50%	0.00%	31.25%	5.21%	NA
Intermediate	90	82.20%	0.00%	14.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207781630	C -> DEL	LOC_Os12g13770.1	N	frameshift_variant	Average:14.709; most accessible tissue: Minghui63 flower, score: 18.473	N	N	N	N
vg1207781630	C -> T	LOC_Os12g13770.1	missense_variant ; p.Glu204Lys; MODERATE	nonsynonymous_codon ; E204K	Average:14.709; most accessible tissue: Minghui63 flower, score: 18.473	unknown	unknown	TOLERATED	0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207781630	1.54E-06	1.54E-06	mr1516	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207781630	7.31E-06	7.51E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207781630	5.40E-06	5.40E-06	mr1810	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251