Variant ID: vg1207774257 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 7774257 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGTATTTGTGATGTATATGGCATTGGATTGTTCCAATTTGTATTGTTGGACAATGTTTTTGACAAGATAAATTCCTCAGTAAACTAATAAGCATTAGAA[G/A]
TATTCTCTAGATAACTCTTCTTTCACCCATATGTTTTATTTTCTTTATATGTCCATGTTCATTTATTCTGATCAGTGTCCGTGGCTTTACCGCGGGGCAC
GTGCCCCGCGGTAAAGCCACGGACACTGATCAGAATAAATGAACATGGACATATAAAGAAAATAAAACATATGGGTGAAAGAAGAGTTATCTAGAGAATA[C/T]
TTCTAATGCTTATTAGTTTACTGAGGAATTTATCTTGTCAAAAACATTGTCCAACAATACAAATTGGAACAATCCAATGCCATATACATCACAAATACAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.00% | 7.90% | 0.08% | 0.00% | NA |
All Indica | 2759 | 86.70% | 13.30% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 97.80% | 1.50% | 0.74% | 0.00% | NA |
Indica I | 595 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 83.10% | 16.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 82.40% | 17.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1207774257 | G -> A | LOC_Os12g13770.1 | downstream_gene_variant ; 2862.0bp to feature; MODIFIER | silent_mutation | Average:56.795; most accessible tissue: Callus, score: 80.491 | N | N | N | N |
vg1207774257 | G -> A | LOC_Os12g13760-LOC_Os12g13770 | intergenic_region ; MODIFIER | silent_mutation | Average:56.795; most accessible tissue: Callus, score: 80.491 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1207774257 | NA | 3.71E-07 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207774257 | 8.33E-07 | 4.34E-07 | mr1196 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207774257 | 8.20E-06 | 8.17E-06 | mr1497 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207774257 | 5.77E-06 | NA | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207774257 | NA | 4.99E-06 | mr1817 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1207774257 | NA | 4.53E-06 | mr1888 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |