\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207742957:

Variant ID: vg1207742957 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7742957
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGCTGGTAGTGGTTGAAGGCCTTTAAACTGACCATATGATCAACTTAATAATAAATGTGTTGAACAAAAAATGCATATAAAGATGGTACAGTGTAGCA[T/G]
TGGTGCGCGATAATGCAGGGTGAATTGTGATCGGTAGCAGCTACGCATACCTTGAGGCTTTTATTGAGCCTTCCAGCAAGTGCTTTCAAGAGTGTGGTTT

Reverse complement sequence

AAACCACACTCTTGAAAGCACTTGCTGGAAGGCTCAATAAAAGCCTCAAGGTATGCGTAGCTGCTACCGATCACAATTCACCCTGCATTATCGCGCACCA[A/C]
TGCTACACTGTACCATCTTTATATGCATTTTTTGTTCAACACATTTATTATTAAGTTGATCATATGGTCAGTTTAAAGGCCTTCAACCACTACCAGCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 24.90% 3.51% 21.20% NA
All Indica  2759 62.60% 7.30% 4.49% 25.59% NA
All Japonica  1512 27.90% 60.20% 2.25% 9.66% NA
Aus  269 55.80% 1.90% 1.49% 40.89% NA
Indica I  595 63.20% 1.70% 11.09% 24.03% NA
Indica II  465 70.10% 4.70% 2.80% 22.37% NA
Indica III  913 65.50% 8.40% 0.88% 25.19% NA
Indica Intermediate  786 54.30% 11.80% 4.71% 29.13% NA
Temperate Japonica  767 22.70% 66.40% 3.13% 7.82% NA
Tropical Japonica  504 29.20% 60.90% 0.40% 9.52% NA
Japonica Intermediate  241 41.90% 39.00% 3.32% 15.77% NA
VI/Aromatic  96 46.90% 22.90% 1.04% 29.17% NA
Intermediate  90 40.00% 43.30% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207742957 T -> DEL N N silent_mutation Average:85.528; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1207742957 T -> G LOC_Os12g13720.1 intron_variant ; MODIFIER silent_mutation Average:85.528; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1207742957 T -> G LOC_Os12g13720.2 intron_variant ; MODIFIER silent_mutation Average:85.528; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207742957 T G 0.06 0.05 0.05 0.06 0.06 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207742957 1.39E-08 3.15E-13 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 7.75E-08 3.87E-12 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 6.78E-07 2.52E-07 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 5.30E-07 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 8.52E-09 1.79E-11 mr1023 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 7.89E-08 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 5.26E-06 NA mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 2.63E-08 1.77E-11 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 1.39E-07 5.66E-11 mr1142 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 4.25E-08 1.14E-11 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 NA 4.89E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 7.83E-07 1.24E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 3.61E-06 1.23E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 1.34E-06 NA mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 2.59E-07 4.50E-11 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 2.37E-06 NA mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 NA 1.59E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 NA 2.59E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742957 6.56E-06 NA mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251