Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207742824:

Variant ID: vg1207742824 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7742824
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCTCCTGTTTCCTGCAATACAGATATGCATAGATACTAAATTTGCAACAGTACACATGGTTGCTGGTTAGTAATTGCATCCGCTATGTTTACAGTTTC[A/T]
AGACCTACATACAACAAAAAAGCGAACATGATGCAGCTGGTAGTGGTTGAAGGCCTTTAAACTGACCATATGATCAACTTAATAATAAATGTGTTGAACA

Reverse complement sequence

TGTTCAACACATTTATTATTAAGTTGATCATATGGTCAGTTTAAAGGCCTTCAACCACTACCAGCTGCATCATGTTCGCTTTTTTGTTGTATGTAGGTCT[T/A]
GAAACTGTAAACATAGCGGATGCAATTACTAACCAGCAACCATGTGTACTGTTGCAAATTTAGTATCTATGCATATCTGTATTGCAGGAAACAGGAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.20%	24.90%	1.99%	2.96%	NA
All Indica	2759	86.30%	7.30%	3.15%	3.19%	NA
All Japonica	1512	39.90%	60.10%	0.00%	0.00%	NA
Aus	269	79.90%	1.90%	2.23%	15.99%	NA
Indica I	595	92.80%	1.70%	3.70%	1.85%	NA
Indica II	465	94.40%	4.90%	0.00%	0.65%	NA
Indica III	913	83.70%	8.40%	2.52%	5.37%	NA
Indica Intermediate	786	79.80%	11.70%	5.34%	3.18%	NA
Temperate Japonica	767	33.80%	66.20%	0.00%	0.00%	NA
Tropical Japonica	504	39.10%	60.90%	0.00%	0.00%	NA
Japonica Intermediate	241	61.40%	38.60%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	22.90%	0.00%	8.33%	NA
Intermediate	90	54.40%	43.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207742824	A -> DEL	N	N	silent_mutation	Average:74.999; most accessible tissue: Minghui63 flag leaf, score: 88.459	N	N	N	N
vg1207742824	A -> T	LOC_Os12g13720.1	intron_variant ; MODIFIER	silent_mutation	Average:74.999; most accessible tissue: Minghui63 flag leaf, score: 88.459	N	N	N	N
vg1207742824	A -> T	LOC_Os12g13720.2	intron_variant ; MODIFIER	silent_mutation	Average:74.999; most accessible tissue: Minghui63 flag leaf, score: 88.459	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1207742824	A	T	0.04	0.02	0.02	0.04	0.04	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207742824	NA	1.00E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824	NA	6.52E-21	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824	NA	3.34E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824	5.96E-06	NA	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824	1.98E-08	NA	mr1080_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824	1.85E-06	NA	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824	6.26E-06	NA	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824	7.28E-06	NA	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251