\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207742824:

Variant ID: vg1207742824 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7742824
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCTCCTGTTTCCTGCAATACAGATATGCATAGATACTAAATTTGCAACAGTACACATGGTTGCTGGTTAGTAATTGCATCCGCTATGTTTACAGTTTC[A/T]
AGACCTACATACAACAAAAAAGCGAACATGATGCAGCTGGTAGTGGTTGAAGGCCTTTAAACTGACCATATGATCAACTTAATAATAAATGTGTTGAACA

Reverse complement sequence

TGTTCAACACATTTATTATTAAGTTGATCATATGGTCAGTTTAAAGGCCTTCAACCACTACCAGCTGCATCATGTTCGCTTTTTTGTTGTATGTAGGTCT[T/A]
GAAACTGTAAACATAGCGGATGCAATTACTAACCAGCAACCATGTGTACTGTTGCAAATTTAGTATCTATGCATATCTGTATTGCAGGAAACAGGAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 24.90% 1.99% 2.96% NA
All Indica  2759 86.30% 7.30% 3.15% 3.19% NA
All Japonica  1512 39.90% 60.10% 0.00% 0.00% NA
Aus  269 79.90% 1.90% 2.23% 15.99% NA
Indica I  595 92.80% 1.70% 3.70% 1.85% NA
Indica II  465 94.40% 4.90% 0.00% 0.65% NA
Indica III  913 83.70% 8.40% 2.52% 5.37% NA
Indica Intermediate  786 79.80% 11.70% 5.34% 3.18% NA
Temperate Japonica  767 33.80% 66.20% 0.00% 0.00% NA
Tropical Japonica  504 39.10% 60.90% 0.00% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 22.90% 0.00% 8.33% NA
Intermediate  90 54.40% 43.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207742824 A -> DEL N N silent_mutation Average:74.999; most accessible tissue: Minghui63 flag leaf, score: 88.459 N N N N
vg1207742824 A -> T LOC_Os12g13720.1 intron_variant ; MODIFIER silent_mutation Average:74.999; most accessible tissue: Minghui63 flag leaf, score: 88.459 N N N N
vg1207742824 A -> T LOC_Os12g13720.2 intron_variant ; MODIFIER silent_mutation Average:74.999; most accessible tissue: Minghui63 flag leaf, score: 88.459 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1207742824 A T 0.04 0.02 0.02 0.04 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207742824 NA 1.00E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824 NA 6.52E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824 NA 3.34E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824 5.96E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824 1.98E-08 NA mr1080_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824 1.85E-06 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824 6.26E-06 NA mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207742824 7.28E-06 NA mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251